Incidental Mutation 'R1018:Lrig1'
List |< first << previous [record 18 of 48] next >> last >|
ID96581
Institutional Source Beutler Lab
Gene Symbol Lrig1
Ensembl Gene ENSMUSG00000030029
Gene Nameleucine-rich repeats and immunoglobulin-like domains 1
SynonymsLIG-1, Img
MMRRC Submission 039122-MU
Accession Numbers

Genbank: NM_008377; MGI: 107935

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1018 (G1)
Quality Score178
Status Validated
Chromosome6
Chromosomal Location94604529-94700158 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 94622602 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032105] [ENSMUST00000101126] [ENSMUST00000204645]
Predicted Effect probably benign
Transcript: ENSMUST00000032105
SMART Domains Protein: ENSMUSP00000032105
Gene: ENSMUSG00000030029

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101126
SMART Domains Protein: ENSMUSP00000098686
Gene: ENSMUSG00000030029

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150811
Predicted Effect probably benign
Transcript: ENSMUST00000204645
SMART Domains Protein: ENSMUSP00000144963
Gene: ENSMUSG00000030029

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype Strain: 2675424
PHENOTYPE: Homozygous null mice developed psoriasiform epidermal hyperplasia. Homozygotes exhibit hair follicle, epidermis, vertebral, eye and hearing abnormalities, decreased body size and fat amount, and increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Lrig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Lrig1 APN 6 94611404 missense probably damaging 0.99
IGL01356:Lrig1 APN 6 94654920 missense probably benign 0.00
IGL01356:Lrig1 APN 6 94609893 missense probably damaging 1.00
IGL02001:Lrig1 APN 6 94607324 missense probably benign 0.00
IGL02019:Lrig1 APN 6 94616429 missense probably damaging 0.98
IGL02177:Lrig1 APN 6 94663996 missense possibly damaging 0.76
IGL02274:Lrig1 APN 6 94663938 missense possibly damaging 0.90
IGL03197:Lrig1 APN 6 94606118 missense probably benign
IGL03263:Lrig1 APN 6 94611647 missense probably benign 0.00
IGL03327:Lrig1 APN 6 94606123 missense probably benign 0.10
N/A - 293:Lrig1 UTSW 6 94609087 missense probably benign
R0019:Lrig1 UTSW 6 94607349 nonsense probably null
R0019:Lrig1 UTSW 6 94607349 nonsense probably null
R0961:Lrig1 UTSW 6 94663914 splice site probably benign
R1381:Lrig1 UTSW 6 94606130 missense probably benign 0.04
R1473:Lrig1 UTSW 6 94607313 missense probably benign 0.16
R1498:Lrig1 UTSW 6 94627987 missense possibly damaging 0.89
R1888:Lrig1 UTSW 6 94654878 missense probably benign 0.03
R1888:Lrig1 UTSW 6 94654878 missense probably benign 0.03
R2273:Lrig1 UTSW 6 94608143 missense probably damaging 1.00
R2513:Lrig1 UTSW 6 94617366 intron probably null
R3001:Lrig1 UTSW 6 94608777 missense probably damaging 1.00
R3002:Lrig1 UTSW 6 94608777 missense probably damaging 1.00
R3732:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3732:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3733:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3772:Lrig1 UTSW 6 94605817 missense probably benign 0.00
R4089:Lrig1 UTSW 6 94609859 missense possibly damaging 0.83
R4093:Lrig1 UTSW 6 94613578 missense probably benign 0.10
R4095:Lrig1 UTSW 6 94613578 missense probably benign 0.10
R4225:Lrig1 UTSW 6 94622658 missense probably damaging 1.00
R4917:Lrig1 UTSW 6 94609719 missense probably damaging 1.00
R4951:Lrig1 UTSW 6 94663978 missense probably damaging 1.00
R4976:Lrig1 UTSW 6 94625062 missense probably damaging 1.00
R5000:Lrig1 UTSW 6 94611449 missense probably damaging 1.00
R5149:Lrig1 UTSW 6 94628044 missense possibly damaging 0.93
R5732:Lrig1 UTSW 6 94699539 nonsense probably null
R5988:Lrig1 UTSW 6 94628042 missense probably damaging 0.99
R6064:Lrig1 UTSW 6 94626447 missense probably damaging 1.00
R6292:Lrig1 UTSW 6 94616445 missense probably damaging 1.00
R6723:Lrig1 UTSW 6 94626405 missense probably damaging 1.00
R6815:Lrig1 UTSW 6 94625029 missense probably damaging 1.00
R6889:Lrig1 UTSW 6 94625063 missense probably benign 0.07
R6995:Lrig1 UTSW 6 94611629 missense possibly damaging 0.95
R7404:Lrig1 UTSW 6 94626471 missense probably damaging 1.00
R7487:Lrig1 UTSW 6 94606118 missense probably benign
R7732:Lrig1 UTSW 6 94626377 missense probably benign 0.05
R8133:Lrig1 UTSW 6 94611629 missense possibly damaging 0.95
Z1176:Lrig1 UTSW 6 94609026 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CTCATCCTGCAATAGGCACCACTG -3'
(R):5'- TGTGGCATGAGACACAACTGAAGAC -3'

Sequencing Primer
(F):5'- CTGCTCAGTAAAGGAAGGATTTAAC -3'
(R):5'- ACATAGCTGCTCAGTGGTGAC -3'
Posted On2014-01-05