Incidental Mutation 'R1018:Arl8b'
List |< first << previous [record 4 of 48] next >> last >|
ID96584
Institutional Source Beutler Lab
Gene Symbol Arl8b
Ensembl Gene ENSMUSG00000030105
Gene NameADP-ribosylation factor-like 8B
Synonyms3100002J04Rik, 2610313E07Rik, Arl10c
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location108783099-108825278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108818611 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 170 (I170K)
Ref Sequence ENSEMBL: ENSMUSP00000032196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032196] [ENSMUST00000204483]
Predicted Effect probably damaging
Transcript: ENSMUST00000032196
AA Change: I170K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032196
Gene: ENSMUSG00000030105
AA Change: I170K

DomainStartEndE-ValueType
ARF 1 185 4.46e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204483
AA Change: I122K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145035
Gene: ENSMUSG00000030105
AA Change: I122K

DomainStartEndE-ValueType
small_GTPase 2 136 3.8e-7 SMART
Meta Mutation Damage Score 0.9635 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display perinatal lethality with impaired visceral yolk sac function and reduced embryo size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Arl8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:Arl8b APN 6 108821557 utr 3 prime probably benign
IGL03135:Arl8b APN 6 108818545 missense probably benign 0.10
R0486:Arl8b UTSW 6 108815326 missense possibly damaging 0.84
R0544:Arl8b UTSW 6 108783228 start gained probably benign
R2248:Arl8b UTSW 6 108783343 missense probably benign 0.00
R2351:Arl8b UTSW 6 108821523 missense possibly damaging 0.84
R3815:Arl8b UTSW 6 108813697 missense probably damaging 1.00
R3816:Arl8b UTSW 6 108813697 missense probably damaging 1.00
R5538:Arl8b UTSW 6 108783336 missense probably damaging 1.00
R6480:Arl8b UTSW 6 108815049 missense possibly damaging 0.79
R7147:Arl8b UTSW 6 108815015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAATGCCTTGGATGAGAAACAGC -3'
(R):5'- TGCTCACTCTCTGCTTTAGGGACTG -3'

Sequencing Primer
(F):5'- AGACTGCCATCTGTTTTGTAAGC -3'
(R):5'- ctaccccttctagttatgagaacc -3'
Posted On2014-01-05