Incidental Mutation 'R1110:Fbxl13'
ID96591
Institutional Source Beutler Lab
Gene Symbol Fbxl13
Ensembl Gene ENSMUSG00000048520
Gene NameF-box and leucine-rich repeat protein 13
Synonyms4921539K22Rik
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1110 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21483847-21645634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21484036 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 758 (D758G)
Ref Sequence ENSEMBL: ENSMUSP00000052716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051358] [ENSMUST00000056045]
Predicted Effect probably benign
Transcript: ENSMUST00000051358
AA Change: D758G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052716
Gene: ENSMUSG00000048520
AA Change: D758G

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 425 4.51e2 SMART
LRR 426 451 2.63e0 SMART
LRR 476 501 4.15e1 SMART
LRR 502 526 1.82e1 SMART
LRR 529 554 1.76e-1 SMART
LRR_CC 555 580 4.61e-5 SMART
LRR 604 629 8.81e-2 SMART
LRR 630 655 2.37e1 SMART
LRR 656 681 3.21e-4 SMART
LRR 682 707 6.57e-1 SMART
LRR 708 733 9.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056045
SMART Domains Protein: ENSMUSP00000058333
Gene: ENSMUSG00000047221

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146056
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL13, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pibf1 C T 14: 99,112,973 R186C probably damaging Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Samd9l T A 6: 3,374,267 D998V probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Urgcp T C 11: 5,716,004 N778S probably benign Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Fbxl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Fbxl13 APN 5 21490414 missense possibly damaging 0.81
IGL02178:Fbxl13 APN 5 21620720 missense possibly damaging 0.56
IGL02271:Fbxl13 APN 5 21490456 missense probably damaging 1.00
IGL02317:Fbxl13 APN 5 21522234 missense probably benign 0.28
IGL02508:Fbxl13 APN 5 21556805 critical splice donor site probably null
IGL02891:Fbxl13 APN 5 21522100 splice site probably benign
IGL03387:Fbxl13 APN 5 21523798 critical splice donor site probably null
laurel UTSW 5 21582053 nonsense probably null
PIT4305001:Fbxl13 UTSW 5 21522148 missense probably benign
R0040:Fbxl13 UTSW 5 21486373 missense probably damaging 1.00
R0040:Fbxl13 UTSW 5 21486373 missense probably damaging 1.00
R0278:Fbxl13 UTSW 5 21523910 missense probably benign 0.03
R0597:Fbxl13 UTSW 5 21614714 missense probably benign 0.09
R1172:Fbxl13 UTSW 5 21620604 splice site probably benign
R1175:Fbxl13 UTSW 5 21620604 splice site probably benign
R1464:Fbxl13 UTSW 5 21483991 missense probably benign 0.21
R1464:Fbxl13 UTSW 5 21483991 missense probably benign 0.21
R2174:Fbxl13 UTSW 5 21582048 missense possibly damaging 0.74
R2426:Fbxl13 UTSW 5 21522137 missense probably damaging 1.00
R4171:Fbxl13 UTSW 5 21543788 missense probably benign 0.02
R4413:Fbxl13 UTSW 5 21582053 nonsense probably null
R4655:Fbxl13 UTSW 5 21582039 missense probably damaging 1.00
R4816:Fbxl13 UTSW 5 21484003 missense probably benign 0.25
R5544:Fbxl13 UTSW 5 21524491 missense probably damaging 0.96
R5979:Fbxl13 UTSW 5 21582091 missense probably damaging 1.00
R6176:Fbxl13 UTSW 5 21500500 missense possibly damaging 0.83
R6211:Fbxl13 UTSW 5 21484021 missense possibly damaging 0.57
R6252:Fbxl13 UTSW 5 21621501 missense possibly damaging 0.96
R6336:Fbxl13 UTSW 5 21523547 critical splice donor site probably null
R6455:Fbxl13 UTSW 5 21556814 missense probably benign 0.02
R6522:Fbxl13 UTSW 5 21561556 unclassified probably null
R6827:Fbxl13 UTSW 5 21522178 missense probably damaging 0.97
R6961:Fbxl13 UTSW 5 21543742 missense probably damaging 1.00
R6998:Fbxl13 UTSW 5 21543689 missense probably damaging 1.00
R6998:Fbxl13 UTSW 5 21620613 missense probably null 0.03
R7152:Fbxl13 UTSW 5 21582067 missense possibly damaging 0.95
R7196:Fbxl13 UTSW 5 21486303 missense probably damaging 0.97
R7418:Fbxl13 UTSW 5 21581983 missense probably benign 0.00
R7490:Fbxl13 UTSW 5 21523060 nonsense probably null
R7649:Fbxl13 UTSW 5 21614666 missense probably benign 0.13
R7816:Fbxl13 UTSW 5 21543787 missense probably benign 0.11
R8036:Fbxl13 UTSW 5 21523568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTTTCCTACATTGTAACCGGGG -3'
(R):5'- GATACTTGTGCCAGAGGAACCTGAC -3'

Sequencing Primer
(F):5'- ctggagaggtggcttagtg -3'
(R):5'- CTCTGCATTAAATGTGACTGGTGAC -3'
Posted On2014-01-05