Incidental Mutation 'R1018:Il16'
Institutional Source Beutler Lab
Gene Symbol Il16
Ensembl Gene ENSMUSG00000001741
Gene Nameinterleukin 16
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosomal Location83642825-83745726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83674538 bp
Amino Acid Change Asparagine to Serine at position 268 (N268S)
Ref Sequence ENSEMBL: ENSMUSP00000001792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000153560]
Predicted Effect probably damaging
Transcript: ENSMUST00000001792
AA Change: N268S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: N268S

low complexity region 76 92 N/A INTRINSIC
low complexity region 99 115 N/A INTRINSIC
PDZ 222 300 6.5e-23 SMART
PDZ 361 438 3.89e-12 SMART
low complexity region 507 526 N/A INTRINSIC
low complexity region 556 577 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 647 680 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 978 989 N/A INTRINSIC
PDZ 1115 1192 3.6e-16 SMART
low complexity region 1201 1216 N/A INTRINSIC
PDZ 1234 1310 4.11e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153560
SMART Domains Protein: ENSMUSP00000118516
Gene: ENSMUSG00000001741

low complexity region 76 92 N/A INTRINSIC
low complexity region 99 115 N/A INTRINSIC
Meta Mutation Damage Score 0.2461 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Il16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Il16 APN 7 83652458 missense probably benign 0.02
IGL01743:Il16 APN 7 83652299 missense probably benign 0.00
IGL01770:Il16 APN 7 83673026 splice site probably benign
IGL02025:Il16 APN 7 83652848 missense probably damaging 1.00
IGL02317:Il16 APN 7 83666889 missense probably damaging 1.00
IGL02412:Il16 APN 7 83652691 missense probably benign 0.03
IGL02550:Il16 APN 7 83674496 missense possibly damaging 0.90
IGL02568:Il16 APN 7 83661276 missense probably damaging 1.00
IGL02578:Il16 APN 7 83677986 critical splice donor site probably null
IGL02815:Il16 APN 7 83651041 missense probably damaging 0.98
IGL03157:Il16 APN 7 83722403 missense probably damaging 1.00
IGL03161:Il16 APN 7 83722499 missense probably damaging 1.00
IGL03188:Il16 APN 7 83688163 missense probably benign 0.00
IGL03213:Il16 APN 7 83646500 missense probably damaging 1.00
IGL03274:Il16 APN 7 83661234 missense probably damaging 1.00
R0201:Il16 UTSW 7 83722308 missense probably damaging 0.99
R0309:Il16 UTSW 7 83722554 missense probably damaging 1.00
R0597:Il16 UTSW 7 83677975 splice site probably benign
R0942:Il16 UTSW 7 83663141 missense probably benign 0.01
R1434:Il16 UTSW 7 83655312 missense probably benign
R1715:Il16 UTSW 7 83648728 missense probably benign 0.01
R2179:Il16 UTSW 7 83688079 splice site probably null
R2520:Il16 UTSW 7 83651994 missense probably benign 0.03
R3425:Il16 UTSW 7 83644040 missense probably damaging 1.00
R3761:Il16 UTSW 7 83650885 missense possibly damaging 0.96
R3943:Il16 UTSW 7 83652015 missense probably damaging 0.97
R4470:Il16 UTSW 7 83650838 intron probably benign
R4530:Il16 UTSW 7 83681310 intron probably benign
R4583:Il16 UTSW 7 83682899 missense probably damaging 1.00
R4777:Il16 UTSW 7 83650896 missense probably benign 0.14
R4874:Il16 UTSW 7 83660945 missense possibly damaging 0.56
R4876:Il16 UTSW 7 83673094 missense probably benign
R5677:Il16 UTSW 7 83674553 missense probably damaging 1.00
R5686:Il16 UTSW 7 83648728 missense probably benign 0.36
R5920:Il16 UTSW 7 83652344 missense probably benign 0.03
R6115:Il16 UTSW 7 83652567 nonsense probably null
R6459:Il16 UTSW 7 83722321 missense probably damaging 1.00
R6459:Il16 UTSW 7 83722328 missense probably damaging 1.00
R6601:Il16 UTSW 7 83722469 missense probably damaging 1.00
R6616:Il16 UTSW 7 83646476 missense probably benign 0.37
R6642:Il16 UTSW 7 83688127 missense probably benign 0.03
R6721:Il16 UTSW 7 83663062 critical splice donor site probably null
R7009:Il16 UTSW 7 83646388 missense probably benign
R7144:Il16 UTSW 7 83646451 missense probably damaging 0.97
R7346:Il16 UTSW 7 83644041 missense probably damaging 1.00
R7403:Il16 UTSW 7 83670135 missense probably damaging 1.00
R7499:Il16 UTSW 7 83674494 missense probably damaging 0.99
R7814:Il16 UTSW 7 83670140 missense possibly damaging 0.46
R7941:Il16 UTSW 7 83682829 missense probably damaging 0.98
R8098:Il16 UTSW 7 83646559 missense probably damaging 1.00
R8317:Il16 UTSW 7 83655330 missense probably benign
R8437:Il16 UTSW 7 83652143 missense probably damaging 1.00
Z1176:Il16 UTSW 7 83652827 missense probably benign 0.05
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agagcagaacagggagagag -3'
Posted On2014-01-05