Incidental Mutation 'R1018:Eed'
List |< first << previous [record 10 of 48] next >> last >|
ID96598
Institutional Source Beutler Lab
Gene Symbol Eed
Ensembl Gene ENSMUSG00000030619
Gene Nameembryonic ectoderm development
Synonymsl7Rn5, l(7)5Rn
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location89954654-89980983 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 89967811 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107234] [ENSMUST00000207980] [ENSMUST00000208977]
Predicted Effect probably benign
Transcript: ENSMUST00000107234
SMART Domains Protein: ENSMUSP00000102853
Gene: ENSMUSG00000030619

DomainStartEndE-ValueType
WD40 81 125 1.43e1 SMART
WD40 131 176 2.04e2 SMART
WD40 179 219 1.3e-7 SMART
WD40 222 264 1.61e-3 SMART
WD40 295 332 7.1e1 SMART
Blast:WD40 349 390 1e-17 BLAST
WD40 397 438 4.3e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207568
Predicted Effect probably benign
Transcript: ENSMUST00000207980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208880
Predicted Effect probably benign
Transcript: ENSMUST00000208977
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein interacts with enhancer of zeste 2, the cytoplasmic tail of integrin beta7, immunodeficiency virus type 1 (HIV-1) MA protein, and histone deacetylase proteins. This protein mediates repression of gene activity through histone deacetylation, and may act as a specific regulator of integrin function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are dwarfed and their coat color is dilute. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Eed
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Eed APN 7 89969595 missense possibly damaging 0.71
IGL02232:Eed APN 7 89972285 missense probably damaging 1.00
IGL02740:Eed APN 7 89972256 missense possibly damaging 0.91
R0417:Eed UTSW 7 89971552 nonsense probably null
R1581:Eed UTSW 7 89980468 missense possibly damaging 0.53
R3959:Eed UTSW 7 89954941 missense probably benign 0.10
R4774:Eed UTSW 7 89964768 missense probably damaging 1.00
R5021:Eed UTSW 7 89972305 missense probably damaging 0.98
R5238:Eed UTSW 7 89976965 missense probably benign
R5561:Eed UTSW 7 89967793 missense probably damaging 1.00
R5959:Eed UTSW 7 89969627 missense probably damaging 1.00
R6223:Eed UTSW 7 89956287 missense probably damaging 1.00
R6391:Eed UTSW 7 89976941 missense probably benign 0.00
R6502:Eed UTSW 7 89977029 missense probably benign 0.00
R7021:Eed UTSW 7 89980519 missense possibly damaging 0.53
R7054:Eed UTSW 7 89964727 critical splice donor site probably null
R7056:Eed UTSW 7 89970356 missense possibly damaging 0.54
R7808:Eed UTSW 7 89956333 missense probably benign 0.04
R7836:Eed UTSW 7 89980814 start gained probably benign
RF029:Eed UTSW 7 89955032 missense probably benign
RF030:Eed UTSW 7 89955032 missense probably benign
Z1177:Eed UTSW 7 89980514 missense probably benign 0.01
Z1177:Eed UTSW 7 89980515 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACAGGCTGCATGAAGCAGAC -3'
(R):5'- AGTGCTCTGAGCAACATCCTCAATG -3'

Sequencing Primer
(F):5'- CATGTTTGCCTACAATGAGAAAAG -3'
(R):5'- GCAACATCCTCAATGTCTGCTG -3'
Posted On2014-01-05