Mutagenetix > Incidental Mutation

Incidental Mutation 'R1110:Kmt2c'

96599

Institutional Source

Beutler Lab

Gene Symbol

Kmt2c

Ensembl Gene

ENSMUSG00000038056

Gene Name

lysine (K)-specific methyltransferase 2C

Synonyms

Mll3, E330008K23Rik, HALR

MMRRC Submission

039183-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1110 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25271798-25498783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25314362 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 2250 (N2250S)

Ref Sequence

ENSEMBL: ENSMUSP00000043874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000173073]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000045291
AA Change: N2250S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: N2250S

Domain	Start	End	E-Value	Type
low complexity region	9	32	N/A	INTRINSIC
AT_hook	34	46	9.68e-1	SMART
low complexity region	73	87	N/A	INTRINSIC
PHD	283	330	2.56e-2	SMART
C1	329	384	5.45e-1	SMART
PHD	342	388	4.19e-7	SMART
RING	343	387	1.45e-1	SMART
PHD	389	435	4.77e-11	SMART
RING	390	434	1.46e0	SMART
PHD	465	517	8.25e-6	SMART
low complexity region	776	789	N/A	INTRINSIC
AT_hook	898	910	1.41e2	SMART
PHD	953	1002	2.89e-10	SMART
RING	954	1001	4.74e0	SMART
C1	994	1045	8.38e-2	SMART
PHD	1003	1049	1.05e-12	SMART
PHD	1080	1131	2.08e-2	SMART
low complexity region	1189	1201	N/A	INTRINSIC
low complexity region	1337	1348	N/A	INTRINSIC
low complexity region	1394	1406	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
low complexity region	1520	1539	N/A	INTRINSIC
low complexity region	1557	1570	N/A	INTRINSIC
HMG	1639	1703	2.64e-3	SMART
low complexity region	1708	1724	N/A	INTRINSIC
coiled coil region	1745	1789	N/A	INTRINSIC
low complexity region	1847	1860	N/A	INTRINSIC
low complexity region	1864	1891	N/A	INTRINSIC
internal_repeat_3	1893	2084	1.27e-14	PROSPERO
internal_repeat_3	2123	2306	1.27e-14	PROSPERO
low complexity region	2336	2348	N/A	INTRINSIC
low complexity region	2375	2394	N/A	INTRINSIC
low complexity region	2427	2440	N/A	INTRINSIC
low complexity region	2516	2527	N/A	INTRINSIC
low complexity region	2696	2720	N/A	INTRINSIC
low complexity region	2723	2742	N/A	INTRINSIC
low complexity region	2930	2943	N/A	INTRINSIC
coiled coil region	3048	3075	N/A	INTRINSIC
low complexity region	3156	3165	N/A	INTRINSIC
low complexity region	3173	3195	N/A	INTRINSIC
coiled coil region	3226	3270	N/A	INTRINSIC
low complexity region	3277	3290	N/A	INTRINSIC
coiled coil region	3389	3427	N/A	INTRINSIC
low complexity region	3460	3486	N/A	INTRINSIC
low complexity region	3597	3611	N/A	INTRINSIC
low complexity region	3649	3667	N/A	INTRINSIC
low complexity region	3769	3783	N/A	INTRINSIC
low complexity region	3822	3827	N/A	INTRINSIC
low complexity region	3860	3869	N/A	INTRINSIC
low complexity region	3887	3904	N/A	INTRINSIC
low complexity region	3994	4009	N/A	INTRINSIC
low complexity region	4015	4038	N/A	INTRINSIC
low complexity region	4293	4309	N/A	INTRINSIC
low complexity region	4412	4419	N/A	INTRINSIC
PHD	4454	4500	2.94e-2	SMART
RING	4455	4499	8.1e0	SMART
FYRN	4554	4597	1.18e-21	SMART
FYRC	4603	4690	4.54e-32	SMART
SET	4764	4886	3.17e-34	SMART
PostSET	4888	4904	1.82e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173073

SMART Domains

Protein: ENSMUSP00000134442
Gene: ENSMUSG00000038056

Domain	Start	End	E-Value	Type
low complexity region	9	32	N/A	INTRINSIC
AT_hook	34	46	9.68e-1	SMART
low complexity region	73	87	N/A	INTRINSIC
PHD	283	330	2.56e-2	SMART
C1	329	384	5.45e-1	SMART
PHD	342	388	4.19e-7	SMART
RING	343	387	1.45e-1	SMART
PHD	389	435	4.77e-11	SMART
RING	390	434	1.46e0	SMART
PHD	465	517	8.25e-6	SMART
low complexity region	776	789	N/A	INTRINSIC
AT_hook	858	870	1.41e2	SMART
PHD	913	962	2.89e-10	SMART
RING	914	961	4.74e0	SMART
C1	954	1005	8.38e-2	SMART
PHD	963	1009	1.05e-12	SMART
PHD	1040	1091	2.08e-2	SMART
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1297	1308	N/A	INTRINSIC
low complexity region	1354	1366	N/A	INTRINSIC
low complexity region	1445	1464	N/A	INTRINSIC
low complexity region	1482	1495	N/A	INTRINSIC
HMG	1564	1628	2.64e-3	SMART
low complexity region	1633	1649	N/A	INTRINSIC
coiled coil region	1670	1714	N/A	INTRINSIC

Meta Mutation Damage Score

0.0580

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 94.3%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap3	T	A	4: 155,905,399		probably null	Het
Acp2	A	G	2: 91,208,422		probably null	Het
Akap13	T	G	7: 75,611,377	S447A	possibly damaging	Het
Alk	G	A	17: 71,984,745		probably benign	Het
Arhgef39	T	C	4: 43,496,834	T327A	probably benign	Het
Cdan1	G	A	2: 120,720,602	A1103V	probably damaging	Het
Cdh18	A	G	15: 23,474,317	T758A	probably benign	Het
Cdk17	T	A	10: 93,239,033	Y3*	probably null	Het
Cdon	T	C	9: 35,456,437		probably benign	Het
Cntn3	T	A	6: 102,245,158	N460I	probably benign	Het
Cntrl	T	A	2: 35,160,627	C985S	possibly damaging	Het
Col6a2	T	C	10: 76,607,740	E497G	probably benign	Het
Crybg1	A	G	10: 43,999,093	M673T	possibly damaging	Het
Cyp2u1	A	G	3: 131,293,609	I441T	possibly damaging	Het
Disp2	T	C	2: 118,790,439	S551P	probably damaging	Het
Dock2	A	T	11: 34,256,535	F1354I	possibly damaging	Het
Dstyk	A	G	1: 132,453,325		probably benign	Het
Dzip1	T	C	14: 118,889,305	N527S	probably benign	Het
Eomes	A	G	9: 118,484,599	I571V	probably benign	Het
Fam26e	T	G	10: 34,096,017	I141L	probably benign	Het
Fbxl13	T	C	5: 21,484,036	D758G	probably benign	Het
Frem1	T	C	4: 82,950,320	S1457G	probably damaging	Het
Gabbr2	C	T	4: 46,718,838	C613Y	probably damaging	Het
Gm906	A	T	13: 50,248,260	D83E	possibly damaging	Het
Gm9755	A	T	8: 67,515,058		noncoding transcript	Het
Hnrnpul2	A	G	19: 8,826,746	R570G	probably damaging	Het
Igdcc4	A	G	9: 65,126,926	H674R	possibly damaging	Het
Kdm5d	T	A	Y: 910,539	L250H	probably damaging	Het
Kif1a	T	C	1: 93,023,453		probably benign	Het
Kmt2e	C	T	5: 23,502,655	H1739Y	probably damaging	Het
Lmtk3	T	A	7: 45,795,003		probably benign	Het
Lpin3	A	G	2: 160,894,079	D93G	probably benign	Het
Myh10	T	C	11: 68,791,850		probably benign	Het
Myom2	G	A	8: 15,122,413	E1171K	probably benign	Het
Ncoa6	A	T	2: 155,411,520		probably benign	Het
Nup160	A	G	2: 90,733,219		probably benign	Het
Oit3	G	A	10: 59,428,194	R373C	probably damaging	Het
Olfml2a	A	T	2: 38,959,753	I494L	probably damaging	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Olfr824	A	G	10: 130,126,653	Y135H	probably damaging	Het
Parp6	G	T	9: 59,649,564	C584F	probably damaging	Het
Pcgf2	A	G	11: 97,691,850		probably benign	Het
Pde3a	T	C	6: 141,459,316		probably benign	Het
Pibf1	C	T	14: 99,112,973	R186C	probably damaging	Het
Pitrm1	A	G	13: 6,558,244	D335G	probably benign	Het
Pkp4	T	C	2: 59,338,765	L752P	probably damaging	Het
Plcb3	C	A	19: 6,961,913	E566*	probably null	Het
Prune2	T	C	19: 17,125,222	S2582P	probably benign	Het
Reln	A	T	5: 22,034,775	D831E	probably benign	Het
Samd9l	T	A	6: 3,374,267	D998V	probably benign	Het
Sardh	G	A	2: 27,191,919	T865I	possibly damaging	Het
Setbp1	G	A	18: 78,857,860	T864I	probably damaging	Het
Slc9a1	T	A	4: 133,370,548	M2K	probably benign	Het
Sorbs2	A	G	8: 45,795,730	T593A	probably benign	Het
Svs5	A	T	2: 164,333,587	I120L	probably benign	Het
Tcl1b1	G	T	12: 105,159,815	V19F	probably damaging	Het
Ttc30a1	A	T	2: 75,979,976	C588S	probably damaging	Het
Urgcp	T	C	11: 5,716,004	N778S	probably benign	Het
Vnn1	A	T	10: 23,899,601	I250F	possibly damaging	Het
Xntrpc	A	G	7: 102,082,974	R365G	possibly damaging	Het
Zfp84	T	A	7: 29,771,372	M1K	probably null	Het
Zfyve26	G	A	12: 79,280,067	R761C	probably damaging	Het
Zp3r	A	G	1: 130,577,884		probably null	Het

Other mutations in Kmt2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Kmt2c	APN	5	25281261	missense	probably damaging	0.99
IGL00694:Kmt2c	APN	5	25293161	missense	probably damaging	0.99
IGL00780:Kmt2c	APN	5	25311051	missense	probably benign	0.00
IGL00811:Kmt2c	APN	5	25374533	missense	possibly damaging	0.75
IGL00885:Kmt2c	APN	5	25409171	missense	possibly damaging	0.80
IGL00948:Kmt2c	APN	5	25377161	missense	probably benign	0.08
IGL00959:Kmt2c	APN	5	25276229	missense	probably damaging	1.00
IGL01022:Kmt2c	APN	5	25302701	unclassified	probably benign
IGL01146:Kmt2c	APN	5	25308512	missense	probably damaging	0.96
IGL01154:Kmt2c	APN	5	25284399	missense	probably damaging	1.00
IGL01434:Kmt2c	APN	5	25409308	missense	probably damaging	1.00
IGL01464:Kmt2c	APN	5	25352244	missense	possibly damaging	0.90
IGL01525:Kmt2c	APN	5	25329441	splice site	probably benign
IGL01530:Kmt2c	APN	5	25313500	missense	probably benign	0.08
IGL01550:Kmt2c	APN	5	25281276	missense	probably damaging	1.00
IGL01598:Kmt2c	APN	5	25273666	makesense	probably null
IGL01598:Kmt2c	APN	5	25354771	missense	probably damaging	1.00
IGL01608:Kmt2c	APN	5	25354811	missense	probably damaging	0.97
IGL01663:Kmt2c	APN	5	25310670	missense	probably damaging	1.00
IGL01707:Kmt2c	APN	5	25300098	missense	probably damaging	1.00
IGL01714:Kmt2c	APN	5	25313400	missense	probably benign
IGL01784:Kmt2c	APN	5	25313526	missense	probably damaging	1.00
IGL01813:Kmt2c	APN	5	25290804	missense	possibly damaging	0.82
IGL01825:Kmt2c	APN	5	25310596	missense	probably damaging	1.00
IGL01834:Kmt2c	APN	5	25395455	missense	probably benign	0.05
IGL02072:Kmt2c	APN	5	25405432	missense	possibly damaging	0.96
IGL02159:Kmt2c	APN	5	25311343	missense	probably benign	0.18
IGL02303:Kmt2c	APN	5	25310157	missense	probably damaging	0.96
IGL02417:Kmt2c	APN	5	25373020	missense	probably benign
IGL02578:Kmt2c	APN	5	25366200	intron	probably benign
IGL02811:Kmt2c	APN	5	25315028	nonsense	probably null
IGL02943:Kmt2c	APN	5	25290823	missense	probably damaging	1.00
IGL03000:Kmt2c	APN	5	25284172	missense	probably damaging	1.00
IGL03040:Kmt2c	APN	5	25310352	missense	probably benign
IGL03076:Kmt2c	APN	5	25299151	nonsense	probably null
IGL03088:Kmt2c	APN	5	25299804	missense	probably damaging	0.99
IGL03131:Kmt2c	APN	5	25315361	missense	probably benign	0.00
FR4304:Kmt2c	UTSW	5	25315766	small insertion	probably benign
FR4976:Kmt2c	UTSW	5	25315763	small insertion	probably benign
PIT4520001:Kmt2c	UTSW	5	25315666	missense	probably benign	0.12
PIT4585001:Kmt2c	UTSW	5	25315106	missense	probably benign	0.21
R0313:Kmt2c	UTSW	5	25344930	missense	probably damaging	1.00
R0374:Kmt2c	UTSW	5	25309708	missense	probably damaging	1.00
R0411:Kmt2c	UTSW	5	25375957	missense	probably damaging	1.00
R0422:Kmt2c	UTSW	5	25315664	missense	probably benign
R0453:Kmt2c	UTSW	5	25354747	missense	probably damaging	1.00
R0616:Kmt2c	UTSW	5	25299252	missense	probably benign
R0619:Kmt2c	UTSW	5	25298916	missense	probably benign	0.21
R0671:Kmt2c	UTSW	5	25404365	missense	probably damaging	1.00
R0736:Kmt2c	UTSW	5	25295434	missense	probably benign
R0745:Kmt2c	UTSW	5	25359698	splice site	probably null
R0760:Kmt2c	UTSW	5	25353317	missense	possibly damaging	0.68
R0784:Kmt2c	UTSW	5	25310895	missense	probably benign	0.00
R0882:Kmt2c	UTSW	5	25295607	missense	possibly damaging	0.90
R0893:Kmt2c	UTSW	5	25351270	splice site	probably benign
R0942:Kmt2c	UTSW	5	25315303	missense	probably benign	0.10
R1137:Kmt2c	UTSW	5	25310983	missense	possibly damaging	0.80
R1255:Kmt2c	UTSW	5	25351153	missense	probably damaging	1.00
R1300:Kmt2c	UTSW	5	25405454	missense	probably damaging	0.99
R1497:Kmt2c	UTSW	5	25314515	missense	possibly damaging	0.80
R1594:Kmt2c	UTSW	5	25314878	missense	probably benign	0.01
R1611:Kmt2c	UTSW	5	25359311	critical splice donor site	probably null
R1617:Kmt2c	UTSW	5	25375927	missense	probably benign	0.01
R1720:Kmt2c	UTSW	5	25299184	missense	probably benign	0.05
R1723:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1724:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1726:Kmt2c	UTSW	5	25315005	missense	probably damaging	1.00
R1736:Kmt2c	UTSW	5	25290527	missense	probably damaging	1.00
R1778:Kmt2c	UTSW	5	25372974	missense	probably benign	0.02
R1809:Kmt2c	UTSW	5	25284192	missense	probably damaging	1.00
R1845:Kmt2c	UTSW	5	25373436	missense	probably benign	0.45
R1895:Kmt2c	UTSW	5	25315154	missense	probably benign	0.34
R1946:Kmt2c	UTSW	5	25315154	missense	probably benign	0.34
R1989:Kmt2c	UTSW	5	25498544	missense	possibly damaging	0.93
R2039:Kmt2c	UTSW	5	25329040	missense	possibly damaging	0.53
R2049:Kmt2c	UTSW	5	25285079	missense	probably damaging	1.00
R2079:Kmt2c	UTSW	5	25352280	missense	possibly damaging	0.82
R2080:Kmt2c	UTSW	5	25354717	missense	probably damaging	1.00
R2107:Kmt2c	UTSW	5	25309824	missense	probably benign	0.01
R2186:Kmt2c	UTSW	5	25287112	missense	probably damaging	1.00
R2395:Kmt2c	UTSW	5	25315152	missense	probably benign
R2983:Kmt2c	UTSW	5	25315757	small deletion	probably benign
R3109:Kmt2c	UTSW	5	25275735	missense	probably damaging	1.00
R3500:Kmt2c	UTSW	5	25299479	missense	probably benign	0.02
R3738:Kmt2c	UTSW	5	25405383	missense	probably benign	0.41
R3809:Kmt2c	UTSW	5	25409138	missense	possibly damaging	0.87
R4088:Kmt2c	UTSW	5	25287713	missense	probably benign
R4107:Kmt2c	UTSW	5	25298920	missense	possibly damaging	0.51
R4212:Kmt2c	UTSW	5	25347359	critical splice donor site	probably null
R4376:Kmt2c	UTSW	5	25315326	missense	probably benign	0.00
R4377:Kmt2c	UTSW	5	25315326	missense	probably benign	0.00
R4383:Kmt2c	UTSW	5	25351062	missense	possibly damaging	0.77
R4435:Kmt2c	UTSW	5	25314877	missense	possibly damaging	0.63
R4456:Kmt2c	UTSW	5	25310212	missense	probably benign
R4461:Kmt2c	UTSW	5	25299876	missense	probably benign	0.00
R4519:Kmt2c	UTSW	5	25363477	missense	probably damaging	1.00
R4550:Kmt2c	UTSW	5	25300174	missense	probably damaging	1.00
R4557:Kmt2c	UTSW	5	25300315	missense	probably damaging	1.00
R4610:Kmt2c	UTSW	5	25354384	missense	probably damaging	1.00
R4671:Kmt2c	UTSW	5	25366177	missense	probably damaging	1.00
R4704:Kmt2c	UTSW	5	25314027	nonsense	probably null
R4781:Kmt2c	UTSW	5	25443825	missense	probably damaging	1.00
R4844:Kmt2c	UTSW	5	25315113	missense	probably benign
R4855:Kmt2c	UTSW	5	25314557	missense	probably benign	0.00
R4919:Kmt2c	UTSW	5	25314395	missense	possibly damaging	0.80
R4971:Kmt2c	UTSW	5	25310872	missense	probably benign	0.00
R4983:Kmt2c	UTSW	5	25295511	missense	possibly damaging	0.51
R5012:Kmt2c	UTSW	5	25299712	nonsense	probably null
R5033:Kmt2c	UTSW	5	25314708	missense	probably benign	0.03
R5093:Kmt2c	UTSW	5	25409207	missense	probably benign	0.17
R5125:Kmt2c	UTSW	5	25284381	missense	probably damaging	0.99
R5231:Kmt2c	UTSW	5	25315473	missense	possibly damaging	0.89
R5254:Kmt2c	UTSW	5	25314594	missense	probably benign	0.01
R5396:Kmt2c	UTSW	5	25294734	splice site	probably null
R5415:Kmt2c	UTSW	5	25314701	missense	probably benign	0.21
R5523:Kmt2c	UTSW	5	25299339	missense	probably benign	0.00
R5554:Kmt2c	UTSW	5	25294610	missense	probably damaging	1.00
R5701:Kmt2c	UTSW	5	25314017	missense	probably benign	0.16
R5762:Kmt2c	UTSW	5	25310457	missense	probably benign	0.01
R5819:Kmt2c	UTSW	5	25409132	critical splice donor site	probably null
R5838:Kmt2c	UTSW	5	25284471	missense	probably damaging	1.00
R5912:Kmt2c	UTSW	5	25347469	missense	possibly damaging	0.80
R5951:Kmt2c	UTSW	5	25330803	missense	probably benign	0.15
R5988:Kmt2c	UTSW	5	25311120	missense	probably benign	0.02
R5999:Kmt2c	UTSW	5	25284205	missense	probably damaging	1.00
R6104:Kmt2c	UTSW	5	25299129	missense	probably benign
R6254:Kmt2c	UTSW	5	25349874	missense	possibly damaging	0.94
R6311:Kmt2c	UTSW	5	25443818	critical splice donor site	probably null
R6329:Kmt2c	UTSW	5	25315602	missense	probably benign	0.01
R6347:Kmt2c	UTSW	5	25310835	missense	possibly damaging	0.54
R6364:Kmt2c	UTSW	5	25309636	missense	probably null	0.99
R6379:Kmt2c	UTSW	5	25359341	missense	probably damaging	1.00
R6588:Kmt2c	UTSW	5	25323789	missense	probably damaging	0.99
R6628:Kmt2c	UTSW	5	25298928	missense	probably benign
R6733:Kmt2c	UTSW	5	25409293	missense	probably damaging	1.00
R6787:Kmt2c	UTSW	5	25275739	splice site	probably null
R6816:Kmt2c	UTSW	5	25405532	splice site	probably null
R6862:Kmt2c	UTSW	5	25310517	missense	probably damaging	1.00
R7150:Kmt2c	UTSW	5	25300362	missense	possibly damaging	0.89
R7220:Kmt2c	UTSW	5	25344925	missense	probably damaging	1.00
R7250:Kmt2c	UTSW	5	25299491	missense	probably damaging	1.00
R7250:Kmt2c	UTSW	5	25309807	missense	probably benign	0.00
R7402:Kmt2c	UTSW	5	25395420	missense	probably damaging	1.00
R7465:Kmt2c	UTSW	5	25302849	missense	probably damaging	1.00
R7467:Kmt2c	UTSW	5	25308532	missense	probably damaging	1.00
R7491:Kmt2c	UTSW	5	25284564	missense	probably damaging	0.99
R7549:Kmt2c	UTSW	5	25414970	missense	possibly damaging	0.95
R7637:Kmt2c	UTSW	5	25315095	missense	probably damaging	1.00
R7652:Kmt2c	UTSW	5	25315719	missense	probably benign	0.01
R7714:Kmt2c	UTSW	5	25375366	missense	probably benign
R7838:Kmt2c	UTSW	5	25294699	missense	possibly damaging	0.57
R7891:Kmt2c	UTSW	5	25300111	missense	probably damaging	1.00
R7892:Kmt2c	UTSW	5	25299816	missense	probably benign	0.18
R7895:Kmt2c	UTSW	5	25373176	missense	possibly damaging	0.65
R7960:Kmt2c	UTSW	5	25315196	missense	probably benign	0.01
R7974:Kmt2c	UTSW	5	25300563	missense	probably damaging	1.00
R7978:Kmt2c	UTSW	5	25359678	missense	probably benign	0.00
R8011:Kmt2c	UTSW	5	25351234	missense	probably damaging	0.99
R8021:Kmt2c	UTSW	5	25287119	missense	possibly damaging	0.88
R8022:Kmt2c	UTSW	5	25281680	missense	possibly damaging	0.83
R8079:Kmt2c	UTSW	5	25302732	missense	probably damaging	0.98
R8087:Kmt2c	UTSW	5	25329252	missense	probably damaging	1.00
R8109:Kmt2c	UTSW	5	25281384	missense	probably damaging	1.00
R8161:Kmt2c	UTSW	5	25374564	missense	probably benign	0.00
R8169:Kmt2c	UTSW	5	25354687	missense	probably damaging	1.00
R8206:Kmt2c	UTSW	5	25314539	missense	probably damaging	0.98
R8218:Kmt2c	UTSW	5	25283106	missense	probably damaging	1.00
R8223:Kmt2c	UTSW	5	25324218	missense	possibly damaging	0.89
R8260:Kmt2c	UTSW	5	25405516	missense	possibly damaging	0.87
R8330:Kmt2c	UTSW	5	25304694	missense	probably null	1.00
R8355:Kmt2c	UTSW	5	25354501	critical splice acceptor site	probably null
R8455:Kmt2c	UTSW	5	25354501	critical splice acceptor site	probably null
R8508:Kmt2c	UTSW	5	25314122	missense	probably benign	0.34
R8885:Kmt2c	UTSW	5	25315079	missense	probably benign	0.34
R8907:Kmt2c	UTSW	5	25309611	missense	probably damaging	1.00
R8924:Kmt2c	UTSW	5	25298887	missense	probably benign
R8969:Kmt2c	UTSW	5	25314389	missense	possibly damaging	0.82
R9019:Kmt2c	UTSW	5	25283210	missense	probably damaging	1.00
R9035:Kmt2c	UTSW	5	25319012	missense	probably damaging	1.00
R9074:Kmt2c	UTSW	5	25284345	missense	probably damaging	1.00
R9125:Kmt2c	UTSW	5	25284196	missense	possibly damaging	0.86
R9130:Kmt2c	UTSW	5	25311104	missense	probably benign	0.01
R9171:Kmt2c	UTSW	5	25281311	missense	probably damaging	1.00
R9235:Kmt2c	UTSW	5	25299999	missense	probably damaging	1.00
R9288:Kmt2c	UTSW	5	25292909	missense	probably damaging	1.00
R9288:Kmt2c	UTSW	5	25349862	missense	probably benign	0.34
R9336:Kmt2c	UTSW	5	25409167	missense	probably benign	0.06
R9443:Kmt2c	UTSW	5	25310047	missense	probably damaging	1.00
R9481:Kmt2c	UTSW	5	25292909	missense	probably damaging	1.00
R9481:Kmt2c	UTSW	5	25349862	missense	probably benign	0.34
R9526:Kmt2c	UTSW	5	25281357	missense	probably damaging	1.00
R9653:Kmt2c	UTSW	5	25302821	missense	probably damaging	1.00
R9729:Kmt2c	UTSW	5	25284760	missense	probably damaging	1.00
R9731:Kmt2c	UTSW	5	25372958	missense	probably benign	0.18
R9784:Kmt2c	UTSW	5	25344961	missense	probably damaging	1.00
RF001:Kmt2c	UTSW	5	25315775	small insertion	probably benign
RF006:Kmt2c	UTSW	5	25315772	small insertion	probably benign
RF011:Kmt2c	UTSW	5	25338459	missense	probably damaging	1.00
RF041:Kmt2c	UTSW	5	25315775	small insertion	probably benign
RF047:Kmt2c	UTSW	5	25315760	small insertion	probably benign
RF051:Kmt2c	UTSW	5	25313479	unclassified	probably benign
RF055:Kmt2c	UTSW	5	25315772	small insertion	probably benign
RF059:Kmt2c	UTSW	5	25313479	unclassified	probably benign
RF063:Kmt2c	UTSW	5	25315764	small insertion	probably benign
X0024:Kmt2c	UTSW	5	25405485	missense	probably benign	0.26
X0027:Kmt2c	UTSW	5	25330887	missense	possibly damaging	0.90
Z1176:Kmt2c	UTSW	5	25354413	missense	probably damaging	1.00
Z1177:Kmt2c	UTSW	5	25295397	critical splice donor site	probably null
Z1177:Kmt2c	UTSW	5	25300003	missense	probably benign	0.00
Z1177:Kmt2c	UTSW	5	25366197	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGGACGGTCAACAAGATCGTGAAC -3'
(R):5'- GCCTGGAACCATATCAAGGTCAGC -3'

Sequencing Primer
(F):5'- ACTAGTTCCGAAAGACTCAGAATG -3'
(R):5'- TATCAAGGTCAGCATCTCAGG -3'

Posted On

2014-01-05