Incidental Mutation 'R1018:Myo7a'
List |< first << previous [record 19 of 48] next >> last >|
ID96600
Institutional Source Beutler Lab
Gene Symbol Myo7a
Ensembl Gene ENSMUSG00000030761
Gene Namemyosin VIIA
SynonymsMyo7, nmf371, polka, Hdb, USH1B
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location98051060-98119524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98107005 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 29 (D29V)
Ref Sequence ENSEMBL: ENSMUSP00000146165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000138627] [ENSMUST00000205746]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084979
AA Change: D29V

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761
AA Change: D29V

DomainStartEndE-ValueType
MYSc 48 731 N/A SMART
IQ 732 754 2.99e0 SMART
IQ 755 777 8.77e-7 SMART
IQ 801 823 8e0 SMART
IQ 824 846 8.7e0 SMART
low complexity region 854 889 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 972 985 N/A INTRINSIC
MyTH4 1006 1242 1.4e-71 SMART
B41 1243 1458 8.82e-42 SMART
SH3 1557 1622 4.93e-7 SMART
MyTH4 1698 1847 3.95e-57 SMART
B41 1849 2066 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107122
AA Change: D29V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761
AA Change: D29V

DomainStartEndE-ValueType
MYSc 48 737 N/A SMART
IQ 738 760 2.99e0 SMART
IQ 761 783 8.77e-7 SMART
IQ 807 829 8e0 SMART
IQ 830 852 8.7e0 SMART
low complexity region 860 895 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 978 991 N/A INTRINSIC
MyTH4 1012 1248 1.4e-71 SMART
B41 1249 1464 8.82e-42 SMART
SH3 1563 1628 4.93e-7 SMART
MyTH4 1704 1853 3.95e-57 SMART
B41 1855 2072 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107127
AA Change: D40V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: D40V

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107128
AA Change: D40V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: D40V

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131632
Predicted Effect probably damaging
Transcript: ENSMUST00000138627
AA Change: D40V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114944
Gene: ENSMUSG00000030761
AA Change: D40V

DomainStartEndE-ValueType
Pfam:Myosin_head 67 139 7.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155637
Predicted Effect probably damaging
Transcript: ENSMUST00000205746
AA Change: D29V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1896 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Myo7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Myo7a APN 7 98102626 missense probably damaging 1.00
IGL00785:Myo7a APN 7 98054348 missense probably damaging 0.99
IGL00840:Myo7a APN 7 98051659 missense probably benign 0.25
IGL01362:Myo7a APN 7 98097702 missense probably damaging 1.00
IGL01484:Myo7a APN 7 98085422 missense probably damaging 1.00
IGL01673:Myo7a APN 7 98054708 missense probably benign 0.00
IGL01933:Myo7a APN 7 98083142 missense probably damaging 1.00
IGL01943:Myo7a APN 7 98065647 missense possibly damaging 0.96
IGL02188:Myo7a APN 7 98091027 missense probably damaging 0.96
IGL02304:Myo7a APN 7 98077736 missense possibly damaging 0.89
IGL02305:Myo7a APN 7 98051629 makesense probably null
IGL02331:Myo7a APN 7 98053182 missense possibly damaging 0.95
IGL02386:Myo7a APN 7 98075112 missense probably damaging 0.99
IGL02389:Myo7a APN 7 98106991 critical splice donor site probably null
IGL02832:Myo7a APN 7 98091020 critical splice donor site probably null
IGL02839:Myo7a APN 7 98091122 missense probably damaging 1.00
IGL03193:Myo7a APN 7 98091057 missense probably damaging 1.00
IGL03237:Myo7a APN 7 98102593 missense probably damaging 1.00
IGL03384:Myo7a APN 7 98093593 missense probably damaging 1.00
coward UTSW 7 98085466 missense probably damaging 1.00
H8786:Myo7a UTSW 7 98095778 missense possibly damaging 0.61
IGL03046:Myo7a UTSW 7 98079327 missense probably damaging 1.00
IGL03134:Myo7a UTSW 7 98056767 missense probably damaging 0.96
PIT4696001:Myo7a UTSW 7 98063599 missense probably benign 0.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0267:Myo7a UTSW 7 98054624 missense probably benign 0.08
R0408:Myo7a UTSW 7 98056781 missense probably damaging 1.00
R0411:Myo7a UTSW 7 98071937 missense probably benign 0.00
R0540:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0607:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0629:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R0632:Myo7a UTSW 7 98112150 intron probably benign
R0659:Myo7a UTSW 7 98054338 splice site probably benign
R0735:Myo7a UTSW 7 98081180 splice site probably benign
R0924:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R0930:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R1196:Myo7a UTSW 7 98097673 missense possibly damaging 0.87
R1331:Myo7a UTSW 7 98107008 missense probably benign 0.00
R1487:Myo7a UTSW 7 98053810 critical splice donor site probably null
R1676:Myo7a UTSW 7 98099472 critical splice donor site probably null
R1695:Myo7a UTSW 7 98092496 missense possibly damaging 0.94
R1770:Myo7a UTSW 7 98112606 intron probably benign
R1781:Myo7a UTSW 7 98073124 missense probably damaging 1.00
R1789:Myo7a UTSW 7 98107095 missense probably damaging 0.99
R1827:Myo7a UTSW 7 98076731 missense probably damaging 0.99
R1864:Myo7a UTSW 7 98052256 missense probably damaging 1.00
R1955:Myo7a UTSW 7 98054921 missense probably damaging 1.00
R2011:Myo7a UTSW 7 98054708 missense possibly damaging 0.69
R2229:Myo7a UTSW 7 98054910 missense probably benign 0.12
R2259:Myo7a UTSW 7 98069499 missense probably damaging 1.00
R2443:Myo7a UTSW 7 98095769 missense probably benign 0.07
R2898:Myo7a UTSW 7 98054424 nonsense probably null
R2898:Myo7a UTSW 7 98097206 missense probably damaging 1.00
R3158:Myo7a UTSW 7 98052292 missense probably damaging 1.00
R3408:Myo7a UTSW 7 98081087 missense probably benign 0.00
R4222:Myo7a UTSW 7 98073229 missense possibly damaging 0.93
R4255:Myo7a UTSW 7 98071964 missense probably damaging 0.96
R4374:Myo7a UTSW 7 98102674 missense probably damaging 1.00
R4429:Myo7a UTSW 7 98053188 missense probably damaging 0.99
R4445:Myo7a UTSW 7 98066404 missense probably damaging 1.00
R4579:Myo7a UTSW 7 98073193 missense probably damaging 1.00
R4659:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R5073:Myo7a UTSW 7 98073218 nonsense probably null
R5138:Myo7a UTSW 7 98083599 missense probably damaging 1.00
R5566:Myo7a UTSW 7 98064816 missense possibly damaging 0.93
R5580:Myo7a UTSW 7 98073160 missense probably damaging 1.00
R6079:Myo7a UTSW 7 98065790 nonsense probably null
R6138:Myo7a UTSW 7 98065790 nonsense probably null
R6451:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6452:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6453:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6454:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6455:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6465:Myo7a UTSW 7 98062680 missense possibly damaging 0.95
R6653:Myo7a UTSW 7 98054503 missense probably damaging 0.96
R6709:Myo7a UTSW 7 98054699 missense probably damaging 1.00
R6917:Myo7a UTSW 7 98095763 missense possibly damaging 0.58
R7313:Myo7a UTSW 7 98064195 missense probably damaging 0.99
R7334:Myo7a UTSW 7 98079366 missense probably benign
R7356:Myo7a UTSW 7 98102683 missense probably benign 0.01
R7393:Myo7a UTSW 7 98063699 missense possibly damaging 0.91
R7422:Myo7a UTSW 7 98051626 splice site probably null
R7472:Myo7a UTSW 7 98064793 missense probably damaging 1.00
R7483:Myo7a UTSW 7 98063674 missense probably benign 0.07
R7526:Myo7a UTSW 7 98085448 missense possibly damaging 0.49
R7948:Myo7a UTSW 7 98075029 missense probably damaging 1.00
R8069:Myo7a UTSW 7 98083626 nonsense probably null
R8115:Myo7a UTSW 7 98066446 missense probably damaging 0.98
R8150:Myo7a UTSW 7 98063639 missense probably benign 0.19
R8265:Myo7a UTSW 7 98085397 missense probably benign 0.00
R8289:Myo7a UTSW 7 98077169 missense probably benign
R8298:Myo7a UTSW 7 98098334 missense probably damaging 1.00
RF005:Myo7a UTSW 7 98093617 missense probably benign 0.42
U15987:Myo7a UTSW 7 98065790 nonsense probably null
X0028:Myo7a UTSW 7 98065725 missense probably damaging 1.00
X0058:Myo7a UTSW 7 98062648 missense probably benign 0.02
Z1176:Myo7a UTSW 7 98095727 missense probably damaging 0.98
Z1177:Myo7a UTSW 7 98052226 missense probably damaging 0.98
Z1177:Myo7a UTSW 7 98085523 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAAGGTTTTGGAGATGTGCAAACCG -3'
(R):5'- AAATCAAGGGTTCCCTCACCCCTG -3'

Sequencing Primer
(F):5'- AGGGAGTCTCTCTTGCAGAGTAG -3'
(R):5'- GTCTTCTGGCTCGGATTCC -3'
Posted On2014-01-05