Incidental Mutation 'R1018:Tbx6'
List |< first << previous [record 36 of 48] next >> last >|
ID96602
Institutional Source Beutler Lab
Gene Symbol Tbx6
Ensembl Gene ENSMUSG00000030699
Gene NameT-box 6
Synonyms
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126781483-126785560 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 126783192 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032936] [ENSMUST00000038614] [ENSMUST00000094037] [ENSMUST00000106356] [ENSMUST00000106357] [ENSMUST00000145762] [ENSMUST00000170882] [ENSMUST00000172352] [ENSMUST00000205786] [ENSMUST00000205935] [ENSMUST00000206353] [ENSMUST00000206570]
Predicted Effect probably benign
Transcript: ENSMUST00000032936
SMART Domains Protein: ENSMUSP00000032936
Gene: ENSMUSG00000030697

DomainStartEndE-ValueType
PP2Ac 20 290 4.04e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038614
SMART Domains Protein: ENSMUSP00000037332
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 6.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094037
SMART Domains Protein: ENSMUSP00000091579
Gene: ENSMUSG00000030699

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 332 348 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106356
SMART Domains Protein: ENSMUSP00000101963
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106357
SMART Domains Protein: ENSMUSP00000101964
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143078
Predicted Effect probably benign
Transcript: ENSMUST00000145762
SMART Domains Protein: ENSMUSP00000115596
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 103 2.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156891
Predicted Effect probably benign
Transcript: ENSMUST00000170882
SMART Domains Protein: ENSMUSP00000128753
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172352
SMART Domains Protein: ENSMUSP00000126418
Gene: ENSMUSG00000030699

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 333 349 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205786
Predicted Effect probably benign
Transcript: ENSMUST00000205935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206261
Predicted Effect probably benign
Transcript: ENSMUST00000206334
Predicted Effect probably benign
Transcript: ENSMUST00000206353
Predicted Effect probably benign
Transcript: ENSMUST00000206477
Predicted Effect probably benign
Transcript: ENSMUST00000206570
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. Knockout studies in mice indicate that this gene is important for specification of paraxial mesoderm structures. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null embryos die during organogenesis exhibiting defects in paraxial mesoderm differentiation, ectopic neural tube development, kinked neural tubes, impaired somite development, hematomas, enlarged tail buds, and laterality defects associated with nodal cilium anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Tbx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tbx6 APN 7 126781529 missense probably damaging 1.00
IGL01899:Tbx6 APN 7 126784532 unclassified probably benign
R1126:Tbx6 UTSW 7 126784719 missense probably damaging 1.00
R2045:Tbx6 UTSW 7 126782883 missense probably damaging 1.00
R4913:Tbx6 UTSW 7 126784535 critical splice acceptor site probably null
R5251:Tbx6 UTSW 7 126783344 missense probably damaging 1.00
R5926:Tbx6 UTSW 7 126784853 missense possibly damaging 0.53
R5927:Tbx6 UTSW 7 126784853 missense possibly damaging 0.53
R6285:Tbx6 UTSW 7 126781568 missense possibly damaging 0.57
R7072:Tbx6 UTSW 7 126784740 missense probably benign 0.37
R8023:Tbx6 UTSW 7 126782859 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GACCGTGTCTACATTCACCCTGAC -3'
(R):5'- GCAAAGGGATTGGCTGCGATCTTC -3'

Sequencing Primer
(F):5'- TGACTCTCCTGCCACTGG -3'
(R):5'- TGTGATCTGAGGACACACAC -3'
Posted On2014-01-05