Incidental Mutation 'R1110:Samd9l'
ID96603
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Namesterile alpha motif domain containing 9-like
SynonymsESTM25
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1110 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location3372257-3399572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3374267 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 998 (D998V)
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
Predicted Effect probably benign
Transcript: ENSMUST00000120087
AA Change: D998V

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: D998V

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Meta Mutation Damage Score 0.2898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Fbxl13 T C 5: 21,484,036 D758G probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pibf1 C T 14: 99,112,973 R186C probably damaging Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Urgcp T C 11: 5,716,004 N778S probably benign Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3376779 missense probably damaging 0.96
IGL00550:Samd9l APN 6 3374594 missense probably benign 0.00
IGL01100:Samd9l APN 6 3375863 missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3376259 missense probably benign 0.42
IGL01553:Samd9l APN 6 3375566 missense probably damaging 0.99
IGL01575:Samd9l APN 6 3376734 missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3375120 missense probably benign 0.02
IGL01915:Samd9l APN 6 3373864 nonsense probably null
IGL02063:Samd9l APN 6 3372992 missense probably damaging 1.00
IGL02066:Samd9l APN 6 3376575 missense probably damaging 1.00
IGL02145:Samd9l APN 6 3374105 missense probably benign 0.13
IGL02163:Samd9l APN 6 3374246 missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3376197 missense probably damaging 1.00
IGL02508:Samd9l APN 6 3374798 missense probably damaging 1.00
IGL02591:Samd9l APN 6 3375760 missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3376026 missense probably damaging 1.00
IGL03058:Samd9l APN 6 3374980 missense probably damaging 0.99
IGL03068:Samd9l APN 6 3375348 nonsense probably null
IGL03160:Samd9l APN 6 3374894 missense probably damaging 1.00
IGL03372:Samd9l APN 6 3375314 missense probably damaging 1.00
IGL03385:Samd9l APN 6 3376208 missense probably damaging 0.99
boston_lager UTSW 6 3375761 missense probably benign 0.12
ipa UTSW 6 3376347 missense probably damaging 1.00
samad UTSW 6 3374032 nonsense probably null
IGL03054:Samd9l UTSW 6 3376023 missense probably damaging 1.00
R0111:Samd9l UTSW 6 3374946 missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3376031 missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3377264 start gained probably benign
R0398:Samd9l UTSW 6 3374502 missense probably damaging 1.00
R0744:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3377064 missense probably damaging 1.00
R1155:Samd9l UTSW 6 3376939 missense probably benign 0.01
R1268:Samd9l UTSW 6 3376113 missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3373947 missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3376369 missense probably benign 0.06
R1573:Samd9l UTSW 6 3375426 missense probably damaging 0.99
R1590:Samd9l UTSW 6 3375761 missense probably benign 0.12
R1611:Samd9l UTSW 6 3373771 missense probably benign 0.00
R1754:Samd9l UTSW 6 3373126 missense probably damaging 0.96
R1759:Samd9l UTSW 6 3373401 missense probably damaging 1.00
R1795:Samd9l UTSW 6 3375264 nonsense probably null
R1829:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3376269 missense probably benign 0.01
R2154:Samd9l UTSW 6 3372945 missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3376910 missense probably benign 0.08
R3622:Samd9l UTSW 6 3374032 nonsense probably null
R3903:Samd9l UTSW 6 3376830 nonsense probably null
R3904:Samd9l UTSW 6 3376830 nonsense probably null
R3945:Samd9l UTSW 6 3377029 missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3376887 missense probably benign 0.22
R4602:Samd9l UTSW 6 3373935 missense probably damaging 1.00
R4602:Samd9l UTSW 6 3373937 frame shift probably null
R4618:Samd9l UTSW 6 3376347 missense probably damaging 1.00
R4747:Samd9l UTSW 6 3375504 nonsense probably null
R4762:Samd9l UTSW 6 3375623 missense probably benign 0.01
R4814:Samd9l UTSW 6 3372863 missense probably damaging 0.98
R4934:Samd9l UTSW 6 3375621 nonsense probably null
R5026:Samd9l UTSW 6 3375284 missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3374157 missense probably benign 0.35
R5130:Samd9l UTSW 6 3374548 missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3376156 missense probably benign 0.02
R5328:Samd9l UTSW 6 3376739 missense probably damaging 0.99
R5507:Samd9l UTSW 6 3373898 missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3373291 missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3376754 missense probably benign
R5881:Samd9l UTSW 6 3372716 missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3376460 missense probably damaging 1.00
R6131:Samd9l UTSW 6 3377252 missense probably benign 0.00
R6199:Samd9l UTSW 6 3376686 missense probably benign 0.13
R6298:Samd9l UTSW 6 3375383 missense probably damaging 1.00
R6331:Samd9l UTSW 6 3376361 missense probably damaging 1.00
R6489:Samd9l UTSW 6 3376896 missense probably benign
R6601:Samd9l UTSW 6 3377229 missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3377247 missense probably benign 0.22
R6803:Samd9l UTSW 6 3375446 missense probably damaging 0.97
R6864:Samd9l UTSW 6 3374750 missense probably benign 0.14
R6905:Samd9l UTSW 6 3375387 missense probably damaging 0.99
R6919:Samd9l UTSW 6 3376313 missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3372716 missense probably damaging 0.99
R7073:Samd9l UTSW 6 3375856 nonsense probably null
R7250:Samd9l UTSW 6 3374201 missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3372600 nonsense probably null
R7351:Samd9l UTSW 6 3374157 missense probably benign 0.35
R7423:Samd9l UTSW 6 3374408 missense probably damaging 1.00
R7610:Samd9l UTSW 6 3376754 missense probably benign
R7667:Samd9l UTSW 6 3375975 missense possibly damaging 0.87
R7672:Samd9l UTSW 6 3373646 missense probably benign 0.16
R7680:Samd9l UTSW 6 3372569 missense probably damaging 1.00
R7680:Samd9l UTSW 6 3376469 missense probably damaging 1.00
R7814:Samd9l UTSW 6 3374793 missense possibly damaging 0.86
R7829:Samd9l UTSW 6 3374749 missense probably benign 0.00
R8000:Samd9l UTSW 6 3373034 missense probably damaging 1.00
R8098:Samd9l UTSW 6 3375549 missense probably damaging 1.00
X0026:Samd9l UTSW 6 3375560 missense probably damaging 1.00
X0066:Samd9l UTSW 6 3374477 missense probably damaging 1.00
Z1176:Samd9l UTSW 6 3376770 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATCACTTCCTGCGATCAAGACC -3'
(R):5'- GAACAAAGAGCCTTTGAGGCCAAAC -3'

Sequencing Primer
(F):5'- CTGCGATCAAGACCTTTTCAG -3'
(R):5'- TACTCTGAAGGACCTGGATGC -3'
Posted On2014-01-05