Incidental Mutation 'R1018:Zfp358'
List |< first << previous [record 47 of 48] next >> last >|
ID96604
Institutional Source Beutler Lab
Gene Symbol Zfp358
Ensembl Gene ENSMUSG00000047264
Gene Namezinc finger protein 358
SynonymsZfend
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3493138-3497208 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 3496843 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 475 (S475*)
Ref Sequence ENSEMBL: ENSMUSP00000146953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004683] [ENSMUST00000061508] [ENSMUST00000160338] [ENSMUST00000207318] [ENSMUST00000208306] [ENSMUST00000208423]
Predicted Effect probably benign
Transcript: ENSMUST00000004683
SMART Domains Protein: ENSMUSP00000004683
Gene: ENSMUSG00000004567

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:PKD_channel 378 524 2.1e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000061508
AA Change: S475*
SMART Domains Protein: ENSMUSP00000060344
Gene: ENSMUSG00000047264
AA Change: S475*

DomainStartEndE-ValueType
low complexity region 24 49 N/A INTRINSIC
ZnF_C2H2 154 176 1.47e-3 SMART
ZnF_C2H2 182 204 2.95e-3 SMART
ZnF_C2H2 210 232 1.67e-2 SMART
ZnF_C2H2 238 260 3.63e-3 SMART
ZnF_C2H2 266 288 2.4e-3 SMART
ZnF_C2H2 294 316 1.4e-4 SMART
ZnF_C2H2 322 344 4.01e-5 SMART
ZnF_C2H2 350 372 2.4e-3 SMART
ZnF_C2H2 378 400 1.84e-4 SMART
low complexity region 422 430 N/A INTRINSIC
low complexity region 447 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160338
SMART Domains Protein: ENSMUSP00000123717
Gene: ENSMUSG00000004567

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207318
Predicted Effect probably benign
Transcript: ENSMUST00000208306
Predicted Effect probably null
Transcript: ENSMUST00000208423
AA Change: S475*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208739
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Zfp358
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Zfp358 APN 8 3495663 missense probably benign 0.19
IGL02301:Zfp358 APN 8 3496858 missense probably benign
IGL02510:Zfp358 APN 8 3496786 missense probably benign 0.04
IGL02860:Zfp358 APN 8 3496074 missense probably damaging 1.00
R1960:Zfp358 UTSW 8 3495742 missense possibly damaging 0.46
R2047:Zfp358 UTSW 8 3495934 missense probably damaging 1.00
R2202:Zfp358 UTSW 8 3496995 missense possibly damaging 0.80
R2354:Zfp358 UTSW 8 3495454 missense possibly damaging 0.95
R4688:Zfp358 UTSW 8 3495493 missense probably damaging 1.00
R4689:Zfp358 UTSW 8 3496146 unclassified probably null
R4876:Zfp358 UTSW 8 3496170 missense probably damaging 0.98
R5830:Zfp358 UTSW 8 3495846 missense probably benign 0.36
R6589:Zfp358 UTSW 8 3495907 missense probably damaging 0.99
R6834:Zfp358 UTSW 8 3495613 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GGCAGAGTTCAGCACTCCTACAAC -3'
(R):5'- TTTATCCATCAGGCCCCAGCAATG -3'

Sequencing Primer
(F):5'- TCAGCTCTGTGGCAAAGC -3'
(R):5'- GGGTCAGTttgggacttgg -3'
Posted On2014-01-05