Incidental Mutation 'R1018:Adam20'
List |< first << previous [record 2 of 48] next >> last >|
ID96606
Institutional Source Beutler Lab
Gene Symbol Adam20
Ensembl Gene ENSMUSG00000046282
Gene Namea disintegrin and metallopeptidase domain 20
Synonyms4930529F22Rik
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location40793273-40797303 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 40796109 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 419 (Q419*)
Ref Sequence ENSEMBL: ENSMUSP00000057794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056331]
Predicted Effect probably null
Transcript: ENSMUST00000056331
AA Change: Q419*
SMART Domains Protein: ENSMUSP00000057794
Gene: ENSMUSG00000046282
AA Change: Q419*

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 51 177 1.3e-19 PFAM
Pfam:Reprolysin_5 219 399 5.4e-16 PFAM
Pfam:Reprolysin_4 219 408 5.4e-11 PFAM
Pfam:Reprolysin 221 411 3.1e-45 PFAM
Pfam:Reprolysin_3 248 366 2.5e-13 PFAM
Pfam:Reprolysin_2 295 403 1e-14 PFAM
DISIN 429 504 4.29e-33 SMART
ACR 505 641 3.9e-74 SMART
transmembrane domain 703 722 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Adam20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Adam20 APN 8 40796047 missense probably benign 0.00
IGL01357:Adam20 APN 8 40796560 missense probably benign 0.09
IGL01877:Adam20 APN 8 40795945 missense probably benign 0.00
IGL02295:Adam20 APN 8 40796836 missense probably damaging 1.00
IGL02683:Adam20 APN 8 40795584 missense probably damaging 0.98
IGL03090:Adam20 APN 8 40794928 missense probably benign 0.00
BB007:Adam20 UTSW 8 40797070 missense probably benign 0.00
BB017:Adam20 UTSW 8 40797070 missense probably benign 0.00
PIT4151001:Adam20 UTSW 8 40795044 missense possibly damaging 0.58
PIT4696001:Adam20 UTSW 8 40794948 missense probably benign 0.20
R0607:Adam20 UTSW 8 40795480 missense probably benign 0.02
R0885:Adam20 UTSW 8 40796558 missense probably benign 0.02
R1147:Adam20 UTSW 8 40795618 missense possibly damaging 0.82
R1147:Adam20 UTSW 8 40795618 missense possibly damaging 0.82
R1421:Adam20 UTSW 8 40796747 missense possibly damaging 0.48
R1739:Adam20 UTSW 8 40796558 missense probably benign 0.02
R1778:Adam20 UTSW 8 40796661 missense possibly damaging 0.92
R1844:Adam20 UTSW 8 40796043 missense probably benign
R3814:Adam20 UTSW 8 40795675 missense probably damaging 1.00
R3877:Adam20 UTSW 8 40796634 missense possibly damaging 0.75
R4193:Adam20 UTSW 8 40795315 missense probably damaging 0.99
R4357:Adam20 UTSW 8 40795047 missense possibly damaging 0.61
R4846:Adam20 UTSW 8 40795011 missense probably benign 0.10
R5452:Adam20 UTSW 8 40795764 missense probably damaging 0.96
R6559:Adam20 UTSW 8 40796292 missense probably benign 0.03
R6708:Adam20 UTSW 8 40796494 missense probably damaging 1.00
R6730:Adam20 UTSW 8 40796659 missense probably benign 0.23
R7194:Adam20 UTSW 8 40796412 missense probably benign 0.45
R7323:Adam20 UTSW 8 40795384 missense probably benign 0.45
R7930:Adam20 UTSW 8 40797070 missense probably benign 0.00
R8006:Adam20 UTSW 8 40795907 missense probably benign 0.02
R8125:Adam20 UTSW 8 40794936 missense probably benign 0.01
R8134:Adam20 UTSW 8 40796064 missense probably benign 0.02
X0062:Adam20 UTSW 8 40797024 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGGGTATGGAGCATGATAGCAGC -3'
(R):5'- AGCAGTAGCCACCATCTCTACAGG -3'

Sequencing Primer
(F):5'- AACCCCGAGTTCAGTAACTG -3'
(R):5'- AGGACACTTATGTGAATGTCCG -3'
Posted On2014-01-05