Mutagenetix > Incidental Mutations

Incidental Mutation 'R1018:Cgnl1'

96612

Institutional Source

Beutler Lab

Gene Symbol

Cgnl1

Ensembl Gene

ENSMUSG00000032232

Gene Name

cingulin-like 1

Synonyms

Jacop, 9930020M10Rik, 4933421H10Rik

MMRRC Submission

039122-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1018 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71626509-71771602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 71726058 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 4 (Y4H)

Ref Sequence

ENSEMBL: ENSMUSP00000112479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]

Predicted Effect

probably damaging
Transcript: ENSMUST00000072899
AA Change: Y4H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: Y4H

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	615	634	N/A	INTRINSIC
low complexity region	638	653	N/A	INTRINSIC
low complexity region	728	739	N/A	INTRINSIC
Pfam:Myosin_tail_1	984	1255	5.4e-30	PFAM
low complexity region	1258	1278	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121322
AA Change: Y4H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: Y4H

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	615	634	N/A	INTRINSIC
low complexity region	638	653	N/A	INTRINSIC
Pfam:Myosin_tail_1	909	1184	2.3e-30	PFAM
low complexity region	1187	1207	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000122065
AA Change: Y4H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: Y4H

Domain	Start	End	E-Value	Type
low complexity region	292	309	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
Pfam:Myosin_tail_1	582	1034	1.3e-12	PFAM
Pfam:Myosin_tail_1	1011	1253	7.7e-38	PFAM
low complexity region	1258	1278	N/A	INTRINSIC

Meta Mutation Damage Score

0.1919

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.7%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	G	T	10: 80,001,491	C403F	probably damaging	Het
Adam20	C	T	8: 40,796,109	Q419*	probably null	Het
Ankrd36	C	T	11: 5,646,876		probably benign	Het
Arl8b	T	A	6: 108,818,611	I170K	probably damaging	Het
Atp5f1	A	T	3: 105,954,172	V78E	possibly damaging	Het
Car9	G	T	4: 43,512,439		probably null	Het
Cnn2	T	C	10: 79,993,563	C176R	probably damaging	Het
Dst	A	G	1: 34,194,093	D3392G	probably damaging	Het
Eed	T	C	7: 89,967,811		probably benign	Het
Efl1	T	A	7: 82,763,013	V870E	possibly damaging	Het
Epx	T	C	11: 87,869,303	N495S	probably benign	Het
Fbxw20	T	A	9: 109,221,336	Y407F	probably benign	Het
Gbp9	T	A	5: 105,080,260	Q552L	probably benign	Het
Hspa13	C	A	16: 75,761,276	V134L	possibly damaging	Het
Il16	T	C	7: 83,674,538	N268S	probably damaging	Het
Kif14	G	A	1: 136,495,841		probably benign	Het
Lrig1	G	A	6: 94,622,602		probably benign	Het
Myo7a	T	A	7: 98,107,005	D29V	probably damaging	Het
Nsd2	A	G	5: 33,843,241	K34R	probably damaging	Het
Olfr1234	C	A	2: 89,363,179	L83F	possibly damaging	Het
P3h1	C	A	4: 119,237,907	T287K	probably damaging	Het
Pkhd1	A	T	1: 20,201,259	H3023Q	possibly damaging	Het
Plxna1	A	G	6: 89,342,960	L535P	probably damaging	Het
Ppp1r32	A	T	19: 10,479,460		probably benign	Het
Prom1	A	T	5: 44,029,714	S400R	probably benign	Het
Psap	T	G	10: 60,300,811	L523R	probably damaging	Het
Psme4	C	T	11: 30,804,310	T189I	probably damaging	Het
Ptpn12	A	T	5: 21,029,869	S39T	possibly damaging	Het
Qtrt2	T	A	16: 43,878,000	H98L	possibly damaging	Het
Rad54l2	C	A	9: 106,712,390	C601F	probably benign	Het
Sfswap	A	G	5: 129,554,576	K756R	possibly damaging	Het
Slc24a5	T	C	2: 125,068,907	V86A	probably damaging	Het
Srrm2	T	C	17: 23,822,540	S2575P	probably damaging	Het
Stam	T	C	2: 14,117,374		probably benign	Het
Tbx6	T	A	7: 126,783,192		probably benign	Het
Tmem131	A	C	1: 36,794,819	F1727V	probably damaging	Het
Tpr	T	A	1: 150,442,183	H2147Q	possibly damaging	Het
Trio	T	A	15: 27,871,171	H620L	probably damaging	Het
Uba5	T	C	9: 104,049,903	T292A	probably benign	Het
Unc5a	T	A	13: 54,990,952	V48E	possibly damaging	Het
Upf1	G	T	8: 70,338,906	H514Q	possibly damaging	Het
Usp9y	A	G	Y: 1,341,414		probably benign	Het
Vmn2r6	T	A	3: 64,556,840	D191V	probably benign	Het
Wapl	T	C	14: 34,691,906	Y242H	possibly damaging	Het
Zfp341	A	T	2: 154,646,052	N812Y	probably damaging	Het
Zfp358	C	A	8: 3,496,843	S475*	probably null	Het
Zfp957	C	A	14: 79,212,742	C539F	probably damaging	Het

Other mutations in Cgnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Cgnl1	APN	9	71656056	missense	probably benign	0.00
IGL01128:Cgnl1	APN	9	71724561	missense	possibly damaging	0.81
IGL01450:Cgnl1	APN	9	71631862	splice site	probably benign
IGL01788:Cgnl1	APN	9	71655390	missense	probably benign
IGL01806:Cgnl1	APN	9	71650322	missense	probably damaging	0.99
IGL01906:Cgnl1	APN	9	71724567	missense	probably benign	0.00
IGL01933:Cgnl1	APN	9	71645483	splice site	probably benign
IGL01939:Cgnl1	APN	9	71725004	missense	probably damaging	1.00
IGL01947:Cgnl1	APN	9	71725044	missense	probably damaging	0.99
IGL02127:Cgnl1	APN	9	71725853	missense	probably damaging	1.00
IGL02379:Cgnl1	APN	9	71645553	missense	possibly damaging	0.82
IGL02510:Cgnl1	APN	9	71725357	missense	probably benign	0.41
FR4548:Cgnl1	UTSW	9	71724717	small insertion	probably benign
R0058:Cgnl1	UTSW	9	71641397	missense	probably damaging	1.00
R0058:Cgnl1	UTSW	9	71724840	missense	probably damaging	0.99
R0105:Cgnl1	UTSW	9	71656102	missense	probably benign
R0220:Cgnl1	UTSW	9	71724943	missense	possibly damaging	0.68
R0242:Cgnl1	UTSW	9	71721657	missense	probably damaging	1.00
R0401:Cgnl1	UTSW	9	71705239	missense	probably damaging	1.00
R0541:Cgnl1	UTSW	9	71651253	missense	possibly damaging	0.54
R1026:Cgnl1	UTSW	9	71717431	missense	possibly damaging	0.91
R1056:Cgnl1	UTSW	9	71725895	missense	probably damaging	1.00
R1299:Cgnl1	UTSW	9	71721712	splice site	probably benign
R1513:Cgnl1	UTSW	9	71724590	missense	probably benign	0.02
R1546:Cgnl1	UTSW	9	71725815	missense	probably benign
R1599:Cgnl1	UTSW	9	71641427	missense	probably benign	0.02
R1657:Cgnl1	UTSW	9	71725944	missense	probably damaging	0.98
R1970:Cgnl1	UTSW	9	71725535	missense	probably benign	0.10
R2004:Cgnl1	UTSW	9	71630539	missense	probably damaging	1.00
R2080:Cgnl1	UTSW	9	71656096	missense	probably benign	0.01
R2085:Cgnl1	UTSW	9	71630878	missense	probably damaging	1.00
R2357:Cgnl1	UTSW	9	71725668	nonsense	probably null
R2402:Cgnl1	UTSW	9	71725179	missense	probably damaging	1.00
R3954:Cgnl1	UTSW	9	71724663	missense	probably benign	0.01
R4043:Cgnl1	UTSW	9	71705293	missense	probably damaging	1.00
R4127:Cgnl1	UTSW	9	71724540	missense	probably benign	0.00
R4825:Cgnl1	UTSW	9	71630524	missense	probably benign	0.00
R4851:Cgnl1	UTSW	9	71725032	missense	probably damaging	1.00
R4882:Cgnl1	UTSW	9	71717401	missense	probably benign	0.00
R4996:Cgnl1	UTSW	9	71724826	small deletion	probably benign
R5057:Cgnl1	UTSW	9	71724794	missense	probably damaging	0.99
R5263:Cgnl1	UTSW	9	71632654	nonsense	probably null
R5402:Cgnl1	UTSW	9	71629321	missense	probably damaging	1.00
R5744:Cgnl1	UTSW	9	71630675	intron	probably null
R5770:Cgnl1	UTSW	9	71645487	splice site	probably null
R6911:Cgnl1	UTSW	9	71656215	missense	possibly damaging	0.82
R7014:Cgnl1	UTSW	9	71725134	missense	possibly damaging	0.86
R7106:Cgnl1	UTSW	9	71725733	missense	probably benign	0.00
R7203:Cgnl1	UTSW	9	71724533	missense	possibly damaging	0.80
R7231:Cgnl1	UTSW	9	71632645	missense	probably benign	0.39
R7241:Cgnl1	UTSW	9	71724770	missense	probably benign
R7288:Cgnl1	UTSW	9	71725564	missense	possibly damaging	0.67
R7327:Cgnl1	UTSW	9	71725883	missense	possibly damaging	0.48
R7390:Cgnl1	UTSW	9	71645649	missense	probably benign	0.04
R7529:Cgnl1	UTSW	9	71631758	missense	probably damaging	1.00
R7793:Cgnl1	UTSW	9	71725635	missense	probably damaging	1.00
RF015:Cgnl1	UTSW	9	71724715	small insertion	probably benign
RF042:Cgnl1	UTSW	9	71724715	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- GACACCGCTCAGTGTTATTCAGGAC -3'
(R):5'- TGGCAAGTCACACAGGCTCAAG -3'

Sequencing Primer
(F):5'- TATTCAGGACTATATAAGGGTGGC -3'
(R):5'- AAGGATggcagggcagg -3'

Posted On

2014-01-05