Incidental Mutation 'R1018:Uba5'
List |< first << previous [record 40 of 48] next >> last >|
ID96614
Institutional Source Beutler Lab
Gene Symbol Uba5
Ensembl Gene ENSMUSG00000032557
Gene Nameubiquitin-like modifier activating enzyme 5
SynonymsUbe1dc1, 5730525G14Rik
MMRRC Submission 039122-MU
Accession Numbers

Genbank: NM_025692; MGI: 1913913

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location104046599-104063134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104049903 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 292 (T292A)
Ref Sequence ENSEMBL: ENSMUSP00000035166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035166] [ENSMUST00000140768] [ENSMUST00000144195]
Predicted Effect probably benign
Transcript: ENSMUST00000035166
AA Change: T292A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000035166
Gene: ENSMUSG00000032557
AA Change: T292A

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 51 309 2.8e-48 PFAM
low complexity region 317 332 N/A INTRINSIC
low complexity region 343 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140768
SMART Domains Protein: ENSMUSP00000118734
Gene: ENSMUSG00000032557

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 70 101 1.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144195
SMART Domains Protein: ENSMUSP00000118535
Gene: ENSMUSG00000032557

DomainStartEndE-ValueType
Pfam:ThiF 1 119 1.9e-22 PFAM
low complexity region 220 235 N/A INTRINSIC
low complexity region 246 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147249
SMART Domains Protein: ENSMUSP00000115381
Gene: ENSMUSG00000101152

DomainStartEndE-ValueType
Pfam:TPR_12 1 48 3e-14 PFAM
Pfam:TPR_12 12 75 2.1e-14 PFAM
Pfam:TPR_10 15 56 7.8e-13 PFAM
Pfam:TPR_1 16 49 4.4e-9 PFAM
Pfam:TPR_7 18 58 7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193689
Predicted Effect probably benign
Transcript: ENSMUST00000214222
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the E1-like ubiquitin-activating enzyme family. This protein activates ubiquitin-fold modifier 1, a ubiquitin-like post-translational modifier protein, via the formation of a high-energy thioester bond. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been identified on chromosome 1. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die at E12.5. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Uba5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Uba5 APN 9 104054060 splice site probably benign
IGL02891:Uba5 APN 9 104054193 splice site probably benign
IGL03182:Uba5 APN 9 104054129 missense possibly damaging 0.78
3-1:Uba5 UTSW 9 104060392 critical splice donor site probably null
PIT4810001:Uba5 UTSW 9 104055197 missense probably damaging 1.00
R0033:Uba5 UTSW 9 104054148 missense probably benign 0.01
R0033:Uba5 UTSW 9 104054148 missense probably benign 0.01
R0745:Uba5 UTSW 9 104049511 unclassified probably benign
R1163:Uba5 UTSW 9 104055826 missense possibly damaging 0.70
R1771:Uba5 UTSW 9 104049908 missense probably damaging 1.00
R2164:Uba5 UTSW 9 104060243 missense probably damaging 1.00
R3916:Uba5 UTSW 9 104054190 missense probably damaging 1.00
R5072:Uba5 UTSW 9 104054427 missense probably damaging 1.00
R5177:Uba5 UTSW 9 104049298 missense probably benign
R5563:Uba5 UTSW 9 104049247 missense probably benign 0.18
R6606:Uba5 UTSW 9 104055221 missense probably damaging 1.00
R7258:Uba5 UTSW 9 104062933 missense unknown
R7337:Uba5 UTSW 9 104055255 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GCAGCACTCAGGAATTCACACAGG -3'
(R):5'- AGAAACAGCTCGTCGTACAGCG -3'

Sequencing Primer
(F):5'- CTCAGGAATTCACACAGGCATTTG -3'
(R):5'- atggagtctcactgtatattcctg -3'
Posted On2014-01-05