Incidental Mutation 'R1018:Psap'
List |< first << previous [record 27 of 48] next >> last >|
ID96622
Institutional Source Beutler Lab
Gene Symbol Psap
Ensembl Gene ENSMUSG00000004207
Gene Nameprosaposin
SynonymsSGP-1
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location60277627-60302597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 60300811 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 523 (L523R)
Ref Sequence ENSEMBL: ENSMUSP00000137476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004316] [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464] [ENSMUST00000105465] [ENSMUST00000165878] [ENSMUST00000177779] [ENSMUST00000179238]
Predicted Effect probably damaging
Transcript: ENSMUST00000004316
AA Change: L522R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004316
Gene: ENSMUSG00000004207
AA Change: L522R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 272 1.2e-16 SMART
SapB 314 389 2.07e-20 SMART
low complexity region 412 430 N/A INTRINSIC
SapB 439 514 3.84e-24 SMART
SAPA 523 556 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073242
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105461
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105462
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105463
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105464
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105465
AA Change: L520R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101105
Gene: ENSMUSG00000004207
AA Change: L520R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 270 2.76e-16 SMART
SapB 312 387 2.07e-20 SMART
low complexity region 410 428 N/A INTRINSIC
SapB 437 512 3.84e-24 SMART
SAPA 521 554 3.19e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156501
Predicted Effect probably damaging
Transcript: ENSMUST00000165878
AA Change: L517R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126407
Gene: ENSMUSG00000004207
AA Change: L517R

DomainStartEndE-ValueType
SAPA 18 51 1.4e-18 SMART
SapB 58 135 1.87e-27 SMART
SapB 192 267 2.76e-16 SMART
SapB 309 384 2.07e-20 SMART
low complexity region 407 425 N/A INTRINSIC
SapB 434 509 3.84e-24 SMART
SAPA 518 551 3.19e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177779
AA Change: L523R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137286
Gene: ENSMUSG00000004207
AA Change: L523R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 2.37e-15 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179238
AA Change: L523R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137476
Gene: ENSMUSG00000004207
AA Change: L523R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 8.5e-17 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a multifunctional glycoprotein that plays a role in the intracellular metabolism of various sphingolipids or secreted into the plasma, milk or cerebrospinal fluid. The encoded protein undergoes proteolytic processing to generate four different polypeptides known as saposin A, B, C or D, that are required for the hydrolysis of certain sphingolipids by lysosomal hydrolases. Alternately, the encoded protein is secreted into body fluids where it exhibits neurotrophic and myelinotrophic activities. A complete lack of the encoded protein is fatal to mice either at the neonatal stage or within the first month due to severe leukodystrophy and sphingolipid accumulation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature saposins. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation die either neonatally or around 7 weeks. At 30 days, mutants show hypomyelination, PAS-positive material in the nervous system, and accumulation of ceramides in brain, liver, and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Psap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Psap APN 10 60292536 missense probably damaging 1.00
IGL01100:Psap APN 10 60299929 missense probably benign 0.03
IGL01122:Psap APN 10 60299474 missense probably benign 0.04
IGL02544:Psap APN 10 60300626 splice site probably benign
twerk UTSW 10 60300851 missense probably damaging 1.00
R0591:Psap UTSW 10 60300855 missense possibly damaging 0.65
R0624:Psap UTSW 10 60299566 splice site probably benign
R1896:Psap UTSW 10 60295046 nonsense probably null
R3161:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3162:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3162:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3615:Psap UTSW 10 60294603 missense probably benign 0.06
R3616:Psap UTSW 10 60294603 missense probably benign 0.06
R4622:Psap UTSW 10 60300851 missense probably damaging 1.00
R4623:Psap UTSW 10 60300851 missense probably damaging 1.00
R4666:Psap UTSW 10 60300545 missense probably benign
R5131:Psap UTSW 10 60299957 missense possibly damaging 0.72
R5203:Psap UTSW 10 60294975 missense probably damaging 1.00
R5251:Psap UTSW 10 60301700 missense probably damaging 0.99
R5511:Psap UTSW 10 60299180 missense possibly damaging 0.51
R5764:Psap UTSW 10 60293406 missense probably benign 0.18
R6207:Psap UTSW 10 60300538 missense probably damaging 1.00
R7003:Psap UTSW 10 60299497 missense probably damaging 1.00
R7494:Psap UTSW 10 60299496 missense probably benign 0.00
R7525:Psap UTSW 10 60299474 missense probably benign 0.04
R7711:Psap UTSW 10 60299855 missense probably damaging 0.96
R8252:Psap UTSW 10 60277689 start gained probably benign
X0019:Psap UTSW 10 60299915 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTGAGTATGAGCCCTTGCTATTGG -3'
(R):5'- TGTTAGAGGCACAGTTAGAGCCTCC -3'

Sequencing Primer
(F):5'- GAGCCCTTGCTATTGGAGATCC -3'
(R):5'- TAGAGCCTCCTGTTCCCATGAG -3'
Posted On2014-01-05