Incidental Mutation 'R1018:Abca7'
ID 96624
Institutional Source Beutler Lab
Gene Symbol Abca7
Ensembl Gene ENSMUSG00000035722
Gene Name ATP-binding cassette, sub-family A member 7
Synonyms Abc51
MMRRC Submission 039122-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1018 (G1)
Quality Score 168
Status Validated
Chromosome 10
Chromosomal Location 79832328-79851406 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 79837325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 403 (C403F)
Ref Sequence ENSEMBL: ENSMUSP00000128121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043866] [ENSMUST00000132517] [ENSMUST00000171637]
AlphaFold Q91V24
Predicted Effect probably damaging
Transcript: ENSMUST00000043866
AA Change: C403F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722
AA Change: C403F

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132517
AA Change: C403F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722
AA Change: C403F

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171637
AA Change: C403F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722
AA Change: C403F

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 517 747 2.8e-19 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1249 1271 N/A INTRINSIC
low complexity region 1307 1317 N/A INTRINSIC
low complexity region 1382 1398 N/A INTRINSIC
Pfam:ABC2_membrane_3 1426 1772 3.9e-47 PFAM
AAA 1841 2026 7.2e-9 SMART
low complexity region 2128 2143 N/A INTRINSIC
Meta Mutation Damage Score 0.5037 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. Defects in this gene cause an increase in amyloid-beta deposits in a mouse model of Alzheimer's disease, and a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant females, but not males, have less white fat and lower total serum and HDL cholesterol levels. Males exhibit a 10% reduction in kidney size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 C T 8: 41,249,146 (GRCm39) Q419* probably null Het
Ankrd36 C T 11: 5,596,876 (GRCm39) probably benign Het
Arl8b T A 6: 108,795,572 (GRCm39) I170K probably damaging Het
Atp5pb A T 3: 105,861,488 (GRCm39) V78E possibly damaging Het
Car9 G T 4: 43,512,439 (GRCm39) probably null Het
Cgnl1 A G 9: 71,633,340 (GRCm39) Y4H probably damaging Het
Cnn2 T C 10: 79,829,397 (GRCm39) C176R probably damaging Het
Dst A G 1: 34,233,174 (GRCm39) D3392G probably damaging Het
Eed T C 7: 89,617,019 (GRCm39) probably benign Het
Efl1 T A 7: 82,412,221 (GRCm39) V870E possibly damaging Het
Epx T C 11: 87,760,129 (GRCm39) N495S probably benign Het
Fbxw20 T A 9: 109,050,404 (GRCm39) Y407F probably benign Het
Gbp9 T A 5: 105,228,126 (GRCm39) Q552L probably benign Het
Hspa13 C A 16: 75,558,164 (GRCm39) V134L possibly damaging Het
Il16 T C 7: 83,323,746 (GRCm39) N268S probably damaging Het
Kif14 G A 1: 136,423,579 (GRCm39) probably benign Het
Lrig1 G A 6: 94,599,583 (GRCm39) probably benign Het
Myo7a T A 7: 97,756,212 (GRCm39) D29V probably damaging Het
Nsd2 A G 5: 34,000,585 (GRCm39) K34R probably damaging Het
Or4a15 C A 2: 89,193,523 (GRCm39) L83F possibly damaging Het
P3h1 C A 4: 119,095,104 (GRCm39) T287K probably damaging Het
Pkhd1 A T 1: 20,271,483 (GRCm39) H3023Q possibly damaging Het
Plxna1 A G 6: 89,319,942 (GRCm39) L535P probably damaging Het
Prom1 A T 5: 44,187,056 (GRCm39) S400R probably benign Het
Psap T G 10: 60,136,590 (GRCm39) L523R probably damaging Het
Psme4 C T 11: 30,754,310 (GRCm39) T189I probably damaging Het
Ptpn12 A T 5: 21,234,867 (GRCm39) S39T possibly damaging Het
Qtrt2 T A 16: 43,698,363 (GRCm39) H98L possibly damaging Het
Rad54l2 C A 9: 106,589,589 (GRCm39) C601F probably benign Het
Saxo4 A T 19: 10,456,824 (GRCm39) probably benign Het
Sfswap A G 5: 129,631,640 (GRCm39) K756R possibly damaging Het
Slc24a5 T C 2: 124,910,827 (GRCm39) V86A probably damaging Het
Srrm2 T C 17: 24,041,514 (GRCm39) S2575P probably damaging Het
Stam T C 2: 14,122,185 (GRCm39) probably benign Het
Tbx6 T A 7: 126,382,364 (GRCm39) probably benign Het
Tmem131 A C 1: 36,833,900 (GRCm39) F1727V probably damaging Het
Tpr T A 1: 150,317,934 (GRCm39) H2147Q possibly damaging Het
Trio T A 15: 27,871,257 (GRCm39) H620L probably damaging Het
Uba5 T C 9: 103,927,102 (GRCm39) T292A probably benign Het
Unc5a T A 13: 55,138,765 (GRCm39) V48E possibly damaging Het
Upf1 G T 8: 70,791,556 (GRCm39) H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 (GRCm39) probably benign Het
Vmn2r6 T A 3: 64,464,261 (GRCm39) D191V probably benign Het
Wapl T C 14: 34,413,863 (GRCm39) Y242H possibly damaging Het
Zfp341 A T 2: 154,487,972 (GRCm39) N812Y probably damaging Het
Zfp358 C A 8: 3,546,843 (GRCm39) S475* probably null Het
Zfp957 C A 14: 79,450,182 (GRCm39) C539F probably damaging Het
Other mutations in Abca7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Abca7 APN 10 79,847,131 (GRCm39) missense probably damaging 0.96
IGL01074:Abca7 APN 10 79,849,726 (GRCm39) missense possibly damaging 0.88
IGL01313:Abca7 APN 10 79,838,957 (GRCm39) splice site probably benign
IGL01372:Abca7 APN 10 79,842,089 (GRCm39) missense probably benign 0.00
IGL01387:Abca7 APN 10 79,835,596 (GRCm39) missense possibly damaging 0.71
IGL01468:Abca7 APN 10 79,839,711 (GRCm39) missense probably benign 0.21
IGL01648:Abca7 APN 10 79,846,914 (GRCm39) missense probably damaging 1.00
IGL01796:Abca7 APN 10 79,849,743 (GRCm39) missense probably damaging 0.99
IGL01977:Abca7 APN 10 79,841,986 (GRCm39) missense probably benign 0.31
IGL01982:Abca7 APN 10 79,838,475 (GRCm39) missense probably damaging 1.00
IGL02115:Abca7 APN 10 79,833,913 (GRCm39) missense probably damaging 1.00
IGL02437:Abca7 APN 10 79,844,223 (GRCm39) missense probably damaging 1.00
IGL02721:Abca7 APN 10 79,849,469 (GRCm39) missense possibly damaging 0.93
IGL02812:Abca7 APN 10 79,841,881 (GRCm39) missense possibly damaging 0.84
IGL02823:Abca7 APN 10 79,844,656 (GRCm39) missense probably damaging 1.00
IGL02827:Abca7 APN 10 79,845,699 (GRCm39) missense probably damaging 1.00
IGL02897:Abca7 APN 10 79,837,426 (GRCm39) missense probably damaging 1.00
IGL02952:Abca7 APN 10 79,843,242 (GRCm39) missense probably damaging 1.00
R0507:Abca7 UTSW 10 79,838,655 (GRCm39) splice site probably benign
R0528:Abca7 UTSW 10 79,838,848 (GRCm39) missense probably damaging 1.00
R0541:Abca7 UTSW 10 79,843,185 (GRCm39) missense probably benign 0.01
R0584:Abca7 UTSW 10 79,847,564 (GRCm39) missense probably damaging 1.00
R1099:Abca7 UTSW 10 79,849,577 (GRCm39) nonsense probably null
R1520:Abca7 UTSW 10 79,844,664 (GRCm39) missense possibly damaging 0.69
R1536:Abca7 UTSW 10 79,850,064 (GRCm39) missense probably benign 0.39
R1619:Abca7 UTSW 10 79,844,889 (GRCm39) missense probably damaging 1.00
R1636:Abca7 UTSW 10 79,844,832 (GRCm39) missense probably benign
R1752:Abca7 UTSW 10 79,842,468 (GRCm39) missense probably benign 0.17
R1762:Abca7 UTSW 10 79,835,599 (GRCm39) missense probably damaging 1.00
R1764:Abca7 UTSW 10 79,844,784 (GRCm39) missense probably damaging 1.00
R1891:Abca7 UTSW 10 79,840,874 (GRCm39) missense possibly damaging 0.72
R1911:Abca7 UTSW 10 79,842,468 (GRCm39) missense probably benign 0.17
R2032:Abca7 UTSW 10 79,844,071 (GRCm39) missense probably damaging 1.00
R2188:Abca7 UTSW 10 79,838,367 (GRCm39) missense probably damaging 1.00
R2973:Abca7 UTSW 10 79,844,801 (GRCm39) missense probably damaging 1.00
R2974:Abca7 UTSW 10 79,844,801 (GRCm39) missense probably damaging 1.00
R3055:Abca7 UTSW 10 79,835,581 (GRCm39) missense probably damaging 1.00
R4496:Abca7 UTSW 10 79,838,768 (GRCm39) missense probably damaging 1.00
R4570:Abca7 UTSW 10 79,842,528 (GRCm39) missense probably damaging 1.00
R4581:Abca7 UTSW 10 79,842,402 (GRCm39) missense probably benign 0.03
R4588:Abca7 UTSW 10 79,833,701 (GRCm39) splice site probably null
R4628:Abca7 UTSW 10 79,851,022 (GRCm39) critical splice donor site probably null
R4641:Abca7 UTSW 10 79,841,615 (GRCm39) critical splice donor site probably null
R4888:Abca7 UTSW 10 79,838,562 (GRCm39) missense probably damaging 0.97
R4911:Abca7 UTSW 10 79,848,022 (GRCm39) critical splice donor site probably null
R4979:Abca7 UTSW 10 79,840,617 (GRCm39) nonsense probably null
R4997:Abca7 UTSW 10 79,843,154 (GRCm39) missense possibly damaging 0.90
R5147:Abca7 UTSW 10 79,851,149 (GRCm39) missense probably benign 0.02
R5176:Abca7 UTSW 10 79,834,123 (GRCm39) missense probably benign 0.35
R5190:Abca7 UTSW 10 79,835,427 (GRCm39) critical splice donor site probably null
R5358:Abca7 UTSW 10 79,849,165 (GRCm39) missense probably damaging 0.99
R5409:Abca7 UTSW 10 79,850,154 (GRCm39) missense probably damaging 1.00
R5705:Abca7 UTSW 10 79,851,276 (GRCm39) missense probably benign
R6246:Abca7 UTSW 10 79,850,999 (GRCm39) missense probably damaging 1.00
R6256:Abca7 UTSW 10 79,838,456 (GRCm39) missense probably damaging 1.00
R6260:Abca7 UTSW 10 79,844,821 (GRCm39) missense probably damaging 1.00
R6275:Abca7 UTSW 10 79,833,625 (GRCm39) missense probably damaging 1.00
R6277:Abca7 UTSW 10 79,841,992 (GRCm39) missense probably benign 0.04
R6284:Abca7 UTSW 10 79,840,244 (GRCm39) missense probably benign
R6307:Abca7 UTSW 10 79,843,221 (GRCm39) missense probably damaging 1.00
R6451:Abca7 UTSW 10 79,842,733 (GRCm39) missense probably damaging 0.99
R6456:Abca7 UTSW 10 79,850,984 (GRCm39) missense probably null 0.69
R6460:Abca7 UTSW 10 79,844,862 (GRCm39) missense probably benign 0.04
R6560:Abca7 UTSW 10 79,843,230 (GRCm39) missense probably damaging 1.00
R6565:Abca7 UTSW 10 79,847,622 (GRCm39) missense probably damaging 1.00
R6644:Abca7 UTSW 10 79,844,598 (GRCm39) missense probably damaging 0.98
R6814:Abca7 UTSW 10 79,838,833 (GRCm39) missense probably damaging 1.00
R7289:Abca7 UTSW 10 79,845,778 (GRCm39) missense probably damaging 1.00
R7303:Abca7 UTSW 10 79,850,822 (GRCm39) missense probably benign 0.17
R7493:Abca7 UTSW 10 79,837,896 (GRCm39) missense probably damaging 0.96
R7535:Abca7 UTSW 10 79,837,463 (GRCm39) missense probably benign 0.04
R7602:Abca7 UTSW 10 79,833,846 (GRCm39) critical splice acceptor site probably null
R7607:Abca7 UTSW 10 79,847,667 (GRCm39) missense probably damaging 1.00
R7647:Abca7 UTSW 10 79,836,656 (GRCm39) missense probably benign 0.00
R7821:Abca7 UTSW 10 79,838,424 (GRCm39) small deletion probably benign
R7863:Abca7 UTSW 10 79,844,655 (GRCm39) missense probably damaging 1.00
R7896:Abca7 UTSW 10 79,840,792 (GRCm39) missense probably damaging 1.00
R7911:Abca7 UTSW 10 79,840,867 (GRCm39) missense probably benign 0.00
R8114:Abca7 UTSW 10 79,844,874 (GRCm39) missense probably damaging 1.00
R8356:Abca7 UTSW 10 79,842,360 (GRCm39) missense probably benign 0.05
R8439:Abca7 UTSW 10 79,841,995 (GRCm39) missense probably benign 0.03
R8456:Abca7 UTSW 10 79,842,360 (GRCm39) missense probably benign 0.05
R8830:Abca7 UTSW 10 79,844,805 (GRCm39) missense probably damaging 1.00
R9004:Abca7 UTSW 10 79,841,483 (GRCm39) missense probably damaging 1.00
R9066:Abca7 UTSW 10 79,849,188 (GRCm39) missense probably damaging 0.98
R9116:Abca7 UTSW 10 79,838,973 (GRCm39) missense
R9128:Abca7 UTSW 10 79,838,352 (GRCm39) missense possibly damaging 0.95
R9141:Abca7 UTSW 10 79,851,264 (GRCm39) missense possibly damaging 0.82
R9184:Abca7 UTSW 10 79,838,690 (GRCm39) missense probably damaging 0.97
R9246:Abca7 UTSW 10 79,838,535 (GRCm39) missense probably damaging 1.00
R9320:Abca7 UTSW 10 79,833,471 (GRCm39) missense possibly damaging 0.55
R9426:Abca7 UTSW 10 79,851,264 (GRCm39) missense possibly damaging 0.82
R9490:Abca7 UTSW 10 79,834,601 (GRCm39) missense probably benign
R9561:Abca7 UTSW 10 79,837,535 (GRCm39) missense probably damaging 1.00
R9672:Abca7 UTSW 10 79,838,563 (GRCm39) missense probably null 1.00
Z1176:Abca7 UTSW 10 79,842,393 (GRCm39) missense probably damaging 1.00
Z1176:Abca7 UTSW 10 79,835,266 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCCTTTCTCCCGAATGATCCTG -3'
(R):5'- CCTCCAATAGCCACGGTCTTGAAC -3'

Sequencing Primer
(F):5'- CCCGAATGATCCTGTCTTGGAG -3'
(R):5'- GTGACATCATCGATATCCATTCG -3'
Posted On 2014-01-05