Mutagenetix > Incidental Mutations

Incidental Mutation 'R1018:Abca7'

96624

Institutional Source

Beutler Lab

Gene Symbol

Abca7

Ensembl Gene

ENSMUSG00000035722

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 7

Synonyms

Abc51

MMRRC Submission

039122-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1018 (G1)

Quality Score

168

Status

Validated

Chromosome

Chromosomal Location

79996494-80015572 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 80001491 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 403 (C403F)

Ref Sequence

ENSEMBL: ENSMUSP00000128121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043866] [ENSMUST00000132517] [ENSMUST00000171637]

AlphaFold

Q91V24

Predicted Effect

probably damaging
Transcript: ENSMUST00000043866
AA Change: C403F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722
AA Change: C403F

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	515	747	1.1e-17	PFAM
AAA	830	1011	4.97e-12	SMART
low complexity region	1136	1147	N/A	INTRINSIC
transmembrane domain	1241	1263	N/A	INTRINSIC
low complexity region	1299	1309	N/A	INTRINSIC
low complexity region	1374	1390	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1427	1764	9e-43	PFAM
AAA	1833	2018	7.2e-9	SMART
low complexity region	2120	2135	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000132517
AA Change: C403F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722
AA Change: C403F

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	515	747	1.1e-17	PFAM
AAA	830	1011	4.97e-12	SMART
low complexity region	1136	1147	N/A	INTRINSIC
transmembrane domain	1241	1263	N/A	INTRINSIC
low complexity region	1299	1309	N/A	INTRINSIC
low complexity region	1374	1390	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1427	1764	9e-43	PFAM
AAA	1833	2018	7.2e-9	SMART
low complexity region	2120	2135	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171637
AA Change: C403F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722
AA Change: C403F

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	517	747	2.8e-19	PFAM
AAA	830	1011	4.97e-12	SMART
low complexity region	1136	1147	N/A	INTRINSIC
transmembrane domain	1249	1271	N/A	INTRINSIC
low complexity region	1307	1317	N/A	INTRINSIC
low complexity region	1382	1398	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1426	1772	3.9e-47	PFAM
AAA	1841	2026	7.2e-9	SMART
low complexity region	2128	2143	N/A	INTRINSIC

Meta Mutation Damage Score

0.5037

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.7%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. Defects in this gene cause an increase in amyloid-beta deposits in a mouse model of Alzheimer's disease, and a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant females, but not males, have less white fat and lower total serum and HDL cholesterol levels. Males exhibit a 10% reduction in kidney size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam20	C	T	8: 40,796,109	Q419*	probably null	Het
Ankrd36	C	T	11: 5,646,876		probably benign	Het
Arl8b	T	A	6: 108,818,611	I170K	probably damaging	Het
Atp5f1	A	T	3: 105,954,172	V78E	possibly damaging	Het
Car9	G	T	4: 43,512,439		probably null	Het
Cgnl1	A	G	9: 71,726,058	Y4H	probably damaging	Het
Cnn2	T	C	10: 79,993,563	C176R	probably damaging	Het
Dst	A	G	1: 34,194,093	D3392G	probably damaging	Het
Eed	T	C	7: 89,967,811		probably benign	Het
Efl1	T	A	7: 82,763,013	V870E	possibly damaging	Het
Epx	T	C	11: 87,869,303	N495S	probably benign	Het
Fbxw20	T	A	9: 109,221,336	Y407F	probably benign	Het
Gbp9	T	A	5: 105,080,260	Q552L	probably benign	Het
Hspa13	C	A	16: 75,761,276	V134L	possibly damaging	Het
Il16	T	C	7: 83,674,538	N268S	probably damaging	Het
Kif14	G	A	1: 136,495,841		probably benign	Het
Lrig1	G	A	6: 94,622,602		probably benign	Het
Myo7a	T	A	7: 98,107,005	D29V	probably damaging	Het
Nsd2	A	G	5: 33,843,241	K34R	probably damaging	Het
Olfr1234	C	A	2: 89,363,179	L83F	possibly damaging	Het
P3h1	C	A	4: 119,237,907	T287K	probably damaging	Het
Pkhd1	A	T	1: 20,201,259	H3023Q	possibly damaging	Het
Plxna1	A	G	6: 89,342,960	L535P	probably damaging	Het
Ppp1r32	A	T	19: 10,479,460		probably benign	Het
Prom1	A	T	5: 44,029,714	S400R	probably benign	Het
Psap	T	G	10: 60,300,811	L523R	probably damaging	Het
Psme4	C	T	11: 30,804,310	T189I	probably damaging	Het
Ptpn12	A	T	5: 21,029,869	S39T	possibly damaging	Het
Qtrt2	T	A	16: 43,878,000	H98L	possibly damaging	Het
Rad54l2	C	A	9: 106,712,390	C601F	probably benign	Het
Sfswap	A	G	5: 129,554,576	K756R	possibly damaging	Het
Slc24a5	T	C	2: 125,068,907	V86A	probably damaging	Het
Srrm2	T	C	17: 23,822,540	S2575P	probably damaging	Het
Stam	T	C	2: 14,117,374		probably benign	Het
Tbx6	T	A	7: 126,783,192		probably benign	Het
Tmem131	A	C	1: 36,794,819	F1727V	probably damaging	Het
Tpr	T	A	1: 150,442,183	H2147Q	possibly damaging	Het
Trio	T	A	15: 27,871,171	H620L	probably damaging	Het
Uba5	T	C	9: 104,049,903	T292A	probably benign	Het
Unc5a	T	A	13: 54,990,952	V48E	possibly damaging	Het
Upf1	G	T	8: 70,338,906	H514Q	possibly damaging	Het
Usp9y	A	G	Y: 1,341,414		probably benign	Het
Vmn2r6	T	A	3: 64,556,840	D191V	probably benign	Het
Wapl	T	C	14: 34,691,906	Y242H	possibly damaging	Het
Zfp341	A	T	2: 154,646,052	N812Y	probably damaging	Het
Zfp358	C	A	8: 3,496,843	S475*	probably null	Het
Zfp957	C	A	14: 79,212,742	C539F	probably damaging	Het

Other mutations in Abca7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Abca7	APN	10	80011297	missense	probably damaging	0.96
IGL01074:Abca7	APN	10	80013892	missense	possibly damaging	0.88
IGL01313:Abca7	APN	10	80003123	splice site	probably benign
IGL01372:Abca7	APN	10	80006255	missense	probably benign	0.00
IGL01387:Abca7	APN	10	79999762	missense	possibly damaging	0.71
IGL01468:Abca7	APN	10	80003877	missense	probably benign	0.21
IGL01648:Abca7	APN	10	80011080	missense	probably damaging	1.00
IGL01796:Abca7	APN	10	80013909	missense	probably damaging	0.99
IGL01977:Abca7	APN	10	80006152	missense	probably benign	0.31
IGL01982:Abca7	APN	10	80002641	missense	probably damaging	1.00
IGL02115:Abca7	APN	10	79998079	missense	probably damaging	1.00
IGL02437:Abca7	APN	10	80008389	missense	probably damaging	1.00
IGL02721:Abca7	APN	10	80013635	missense	possibly damaging	0.93
IGL02812:Abca7	APN	10	80006047	missense	possibly damaging	0.84
IGL02823:Abca7	APN	10	80008822	missense	probably damaging	1.00
IGL02827:Abca7	APN	10	80009865	missense	probably damaging	1.00
IGL02897:Abca7	APN	10	80001592	missense	probably damaging	1.00
IGL02952:Abca7	APN	10	80007408	missense	probably damaging	1.00
R0507:Abca7	UTSW	10	80002821	splice site	probably benign
R0528:Abca7	UTSW	10	80003014	missense	probably damaging	1.00
R0541:Abca7	UTSW	10	80007351	missense	probably benign	0.01
R0584:Abca7	UTSW	10	80011730	missense	probably damaging	1.00
R1099:Abca7	UTSW	10	80013743	nonsense	probably null
R1520:Abca7	UTSW	10	80008830	missense	possibly damaging	0.69
R1536:Abca7	UTSW	10	80014230	missense	probably benign	0.39
R1619:Abca7	UTSW	10	80009055	missense	probably damaging	1.00
R1636:Abca7	UTSW	10	80008998	missense	probably benign
R1752:Abca7	UTSW	10	80006634	missense	probably benign	0.17
R1762:Abca7	UTSW	10	79999765	missense	probably damaging	1.00
R1764:Abca7	UTSW	10	80008950	missense	probably damaging	1.00
R1891:Abca7	UTSW	10	80005040	missense	possibly damaging	0.72
R1911:Abca7	UTSW	10	80006634	missense	probably benign	0.17
R2032:Abca7	UTSW	10	80008237	missense	probably damaging	1.00
R2188:Abca7	UTSW	10	80002533	missense	probably damaging	1.00
R2973:Abca7	UTSW	10	80008967	missense	probably damaging	1.00
R2974:Abca7	UTSW	10	80008967	missense	probably damaging	1.00
R3055:Abca7	UTSW	10	79999747	missense	probably damaging	1.00
R4496:Abca7	UTSW	10	80002934	missense	probably damaging	1.00
R4570:Abca7	UTSW	10	80006694	missense	probably damaging	1.00
R4581:Abca7	UTSW	10	80006568	missense	probably benign	0.03
R4588:Abca7	UTSW	10	79997867	splice site	probably null
R4628:Abca7	UTSW	10	80015188	critical splice donor site	probably null
R4641:Abca7	UTSW	10	80005781	critical splice donor site	probably null
R4888:Abca7	UTSW	10	80002728	missense	probably damaging	0.97
R4911:Abca7	UTSW	10	80012188	critical splice donor site	probably null
R4979:Abca7	UTSW	10	80004783	nonsense	probably null
R4997:Abca7	UTSW	10	80007320	missense	possibly damaging	0.90
R5147:Abca7	UTSW	10	80015315	missense	probably benign	0.02
R5176:Abca7	UTSW	10	79998289	missense	probably benign	0.35
R5190:Abca7	UTSW	10	79999593	critical splice donor site	probably null
R5358:Abca7	UTSW	10	80013331	missense	probably damaging	0.99
R5409:Abca7	UTSW	10	80014320	missense	probably damaging	1.00
R5705:Abca7	UTSW	10	80015442	missense	probably benign
R6246:Abca7	UTSW	10	80015165	missense	probably damaging	1.00
R6256:Abca7	UTSW	10	80002622	missense	probably damaging	1.00
R6260:Abca7	UTSW	10	80008987	missense	probably damaging	1.00
R6275:Abca7	UTSW	10	79997791	missense	probably damaging	1.00
R6277:Abca7	UTSW	10	80006158	missense	probably benign	0.04
R6284:Abca7	UTSW	10	80004410	missense	probably benign
R6307:Abca7	UTSW	10	80007387	missense	probably damaging	1.00
R6451:Abca7	UTSW	10	80006899	missense	probably damaging	0.99
R6456:Abca7	UTSW	10	80015150	missense	probably null	0.69
R6460:Abca7	UTSW	10	80009028	missense	probably benign	0.04
R6560:Abca7	UTSW	10	80007396	missense	probably damaging	1.00
R6565:Abca7	UTSW	10	80011788	missense	probably damaging	1.00
R6644:Abca7	UTSW	10	80008764	missense	probably damaging	0.98
R6814:Abca7	UTSW	10	80002999	missense	probably damaging	1.00
R7289:Abca7	UTSW	10	80009944	missense	probably damaging	1.00
R7303:Abca7	UTSW	10	80014988	missense	probably benign	0.17
R7493:Abca7	UTSW	10	80002062	missense	probably damaging	0.96
R7535:Abca7	UTSW	10	80001629	missense	probably benign	0.04
R7602:Abca7	UTSW	10	79998012	critical splice acceptor site	probably null
R7607:Abca7	UTSW	10	80011833	missense	probably damaging	1.00
R7647:Abca7	UTSW	10	80000822	missense	probably benign	0.00
R7821:Abca7	UTSW	10	80002590	small deletion	probably benign
R7863:Abca7	UTSW	10	80008821	missense	probably damaging	1.00
R7896:Abca7	UTSW	10	80004958	missense	probably damaging	1.00
R7911:Abca7	UTSW	10	80005033	missense	probably benign	0.00
R8114:Abca7	UTSW	10	80009040	missense	probably damaging	1.00
R8356:Abca7	UTSW	10	80006526	missense	probably benign	0.05
R8439:Abca7	UTSW	10	80006161	missense	probably benign	0.03
R8456:Abca7	UTSW	10	80006526	missense	probably benign	0.05
R8830:Abca7	UTSW	10	80008971	missense	probably damaging	1.00
R9004:Abca7	UTSW	10	80005649	missense	probably damaging	1.00
R9066:Abca7	UTSW	10	80013354	missense	probably damaging	0.98
R9116:Abca7	UTSW	10	80003139	missense
R9128:Abca7	UTSW	10	80002518	missense	possibly damaging	0.95
R9141:Abca7	UTSW	10	80015430	missense	possibly damaging	0.82
R9184:Abca7	UTSW	10	80002856	missense	probably damaging	0.97
R9246:Abca7	UTSW	10	80002701	missense	probably damaging	1.00
R9320:Abca7	UTSW	10	79997637	missense	possibly damaging	0.55
R9426:Abca7	UTSW	10	80015430	missense	possibly damaging	0.82
Z1176:Abca7	UTSW	10	79999432	nonsense	probably null
Z1176:Abca7	UTSW	10	80006559	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCCTTTCTCCCGAATGATCCTG -3'
(R):5'- CCTCCAATAGCCACGGTCTTGAAC -3'

Sequencing Primer
(F):5'- CCCGAATGATCCTGTCTTGGAG -3'
(R):5'- GTGACATCATCGATATCCATTCG -3'

Posted On

2014-01-05