Mutagenetix > Incidental Mutations

Incidental Mutation 'R1110:Sorbs2'

96625

Institutional Source

Beutler Lab

Gene Symbol

Sorbs2

Ensembl Gene

ENSMUSG00000031626

Gene Name

sorbin and SH3 domain containing 2

Synonyms

MMRRC Submission

039183-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1110 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45507788-45827906 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 45795730 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 593 (T593A)

Ref Sequence

ENSEMBL: ENSMUSP00000116768 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000171337] [ENSMUST00000211095] [ENSMUST00000153798]

Predicted Effect

probably benign
Transcript: ENSMUST00000067065
AA Change: T538A

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626
AA Change: T538A

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	105	121	N/A	INTRINSIC
low complexity region	136	154	N/A	INTRINSIC
low complexity region	266	283	N/A	INTRINSIC
low complexity region	362	373	N/A	INTRINSIC
low complexity region	606	618	N/A	INTRINSIC
low complexity region	619	630	N/A	INTRINSIC
SH3	845	900	5.1e-23	SMART
low complexity region	901	916	N/A	INTRINSIC
SH3	920	977	3.9e-19	SMART
SH3	1023	1079	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000067107
AA Change: T654A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626
AA Change: T654A

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125295
AA Change: T593A

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626
AA Change: T593A

Domain	Start	End	E-Value	Type
Sorb	6	56	9.63e-34	SMART
low complexity region	103	116	N/A	INTRINSIC
low complexity region	160	176	N/A	INTRINSIC
low complexity region	191	209	N/A	INTRINSIC
low complexity region	321	338	N/A	INTRINSIC
low complexity region	417	428	N/A	INTRINSIC
low complexity region	661	673	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
SH3	900	955	5.1e-23	SMART
low complexity region	956	971	N/A	INTRINSIC
SH3	975	1032	3.9e-19	SMART
SH3	1078	1134	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130011

SMART Domains

Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	113	163	1.01e-27	SMART
low complexity region	195	208	N/A	INTRINSIC
low complexity region	252	268	N/A	INTRINSIC
low complexity region	283	301	N/A	INTRINSIC
low complexity region	366	383	N/A	INTRINSIC
SH3	418	473	5.1e-23	SMART
low complexity region	474	489	N/A	INTRINSIC
SH3	493	550	3.9e-19	SMART
SH3	596	652	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132139

SMART Domains

Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	144	194	9.63e-34	SMART
low complexity region	241	254	N/A	INTRINSIC
low complexity region	298	314	N/A	INTRINSIC
low complexity region	329	347	N/A	INTRINSIC
low complexity region	431	448	N/A	INTRINSIC
SH3	483	538	5.1e-23	SMART
low complexity region	539	554	N/A	INTRINSIC
SH3	558	615	3.9e-19	SMART
SH3	636	707	2.16e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132767

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135116

Predicted Effect

probably benign
Transcript: ENSMUST00000135336
AA Change: T654A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626
AA Change: T654A

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138049

SMART Domains

Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	167	217	1.01e-27	SMART
low complexity region	249	262	N/A	INTRINSIC
low complexity region	367	384	N/A	INTRINSIC
low complexity region	463	474	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139869

SMART Domains

Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	136	186	1.01e-27	SMART
low complexity region	218	231	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
SH3	389	444	5.1e-23	SMART
low complexity region	445	460	N/A	INTRINSIC
SH3	464	521	3.9e-19	SMART
SH3	567	623	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140088

SMART Domains

Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	2	25	9.17e-1	SMART
low complexity region	57	70	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146627

SMART Domains

Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	10	26	N/A	INTRINSIC
low complexity region	41	59	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171337
AA Change: T673A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626
AA Change: T673A

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	401	418	N/A	INTRINSIC
low complexity region	497	508	N/A	INTRINSIC
low complexity region	741	753	N/A	INTRINSIC
low complexity region	754	765	N/A	INTRINSIC
SH3	980	1035	5.1e-23	SMART
low complexity region	1036	1051	N/A	INTRINSIC
SH3	1055	1112	3.9e-19	SMART
SH3	1158	1214	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000211095

Predicted Effect

probably benign
Transcript: ENSMUST00000153798

SMART Domains

Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	136	186	9.63e-34	SMART
low complexity region	233	246	N/A	INTRINSIC
low complexity region	351	368	N/A	INTRINSIC
SH3	403	458	5.1e-23	SMART
low complexity region	459	474	N/A	INTRINSIC
SH3	478	535	3.9e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155858

SMART Domains

Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	50	63	N/A	INTRINSIC
low complexity region	107	123	N/A	INTRINSIC
low complexity region	138	156	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 94.3%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap3	T	A	4: 155,905,399		probably null	Het
Acp2	A	G	2: 91,208,422		probably null	Het
Akap13	T	G	7: 75,611,377	S447A	possibly damaging	Het
Alk	G	A	17: 71,984,745		probably benign	Het
Arhgef39	T	C	4: 43,496,834	T327A	probably benign	Het
Cdan1	G	A	2: 120,720,602	A1103V	probably damaging	Het
Cdh18	A	G	15: 23,474,317	T758A	probably benign	Het
Cdk17	T	A	10: 93,239,033	Y3*	probably null	Het
Cdon	T	C	9: 35,456,437		probably benign	Het
Cntn3	T	A	6: 102,245,158	N460I	probably benign	Het
Cntrl	T	A	2: 35,160,627	C985S	possibly damaging	Het
Col6a2	T	C	10: 76,607,740	E497G	probably benign	Het
Crybg1	A	G	10: 43,999,093	M673T	possibly damaging	Het
Cyp2u1	A	G	3: 131,293,609	I441T	possibly damaging	Het
Disp2	T	C	2: 118,790,439	S551P	probably damaging	Het
Dock2	A	T	11: 34,256,535	F1354I	possibly damaging	Het
Dstyk	A	G	1: 132,453,325		probably benign	Het
Dzip1	T	C	14: 118,889,305	N527S	probably benign	Het
Eomes	A	G	9: 118,484,599	I571V	probably benign	Het
Fam26e	T	G	10: 34,096,017	I141L	probably benign	Het
Fbxl13	T	C	5: 21,484,036	D758G	probably benign	Het
Frem1	T	C	4: 82,950,320	S1457G	probably damaging	Het
Gabbr2	C	T	4: 46,718,838	C613Y	probably damaging	Het
Gm906	A	T	13: 50,248,260	D83E	possibly damaging	Het
Gm9755	A	T	8: 67,515,058		noncoding transcript	Het
Hnrnpul2	A	G	19: 8,826,746	R570G	probably damaging	Het
Igdcc4	A	G	9: 65,126,926	H674R	possibly damaging	Het
Kdm5d	T	A	Y: 910,539	L250H	probably damaging	Het
Kif1a	T	C	1: 93,023,453		probably benign	Het
Kmt2c	T	C	5: 25,314,362	N2250S	probably benign	Het
Kmt2e	C	T	5: 23,502,655	H1739Y	probably damaging	Het
Lmtk3	T	A	7: 45,795,003		probably benign	Het
Lpin3	A	G	2: 160,894,079	D93G	probably benign	Het
Myh10	T	C	11: 68,791,850		probably benign	Het
Myom2	G	A	8: 15,122,413	E1171K	probably benign	Het
Ncoa6	A	T	2: 155,411,520		probably benign	Het
Nup160	A	G	2: 90,733,219		probably benign	Het
Oit3	G	A	10: 59,428,194	R373C	probably damaging	Het
Olfml2a	A	T	2: 38,959,753	I494L	probably damaging	Het
Olfr743	T	C	14: 50,533,702	S97P	possibly damaging	Het
Olfr824	A	G	10: 130,126,653	Y135H	probably damaging	Het
Parp6	G	T	9: 59,649,564	C584F	probably damaging	Het
Pcgf2	A	G	11: 97,691,850		probably benign	Het
Pde3a	T	C	6: 141,459,316		probably benign	Het
Pibf1	C	T	14: 99,112,973	R186C	probably damaging	Het
Pitrm1	A	G	13: 6,558,244	D335G	probably benign	Het
Pkp4	T	C	2: 59,338,765	L752P	probably damaging	Het
Plcb3	C	A	19: 6,961,913	E566*	probably null	Het
Prune2	T	C	19: 17,125,222	S2582P	probably benign	Het
Reln	A	T	5: 22,034,775	D831E	probably benign	Het
Samd9l	T	A	6: 3,374,267	D998V	probably benign	Het
Sardh	G	A	2: 27,191,919	T865I	possibly damaging	Het
Setbp1	G	A	18: 78,857,860	T864I	probably damaging	Het
Slc9a1	T	A	4: 133,370,548	M2K	probably benign	Het
Svs5	A	T	2: 164,333,587	I120L	probably benign	Het
Tcl1b1	G	T	12: 105,159,815	V19F	probably damaging	Het
Ttc30a1	A	T	2: 75,979,976	C588S	probably damaging	Het
Urgcp	T	C	11: 5,716,004	N778S	probably benign	Het
Vnn1	A	T	10: 23,899,601	I250F	possibly damaging	Het
Xntrpc	A	G	7: 102,082,974	R365G	possibly damaging	Het
Zfp84	T	A	7: 29,771,372	M1K	probably null	Het
Zfyve26	G	A	12: 79,280,067	R761C	probably damaging	Het
Zp3r	A	G	1: 130,577,884		probably null	Het

Other mutations in Sorbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Sorbs2	APN	8	45799706	splice site	probably null
IGL00964:Sorbs2	APN	8	45795677	missense	probably damaging	0.97
IGL01101:Sorbs2	APN	8	45745423	missense	possibly damaging	0.93
IGL01586:Sorbs2	APN	8	45795594	missense	probably damaging	1.00
IGL01611:Sorbs2	APN	8	45795344	missense	probably null
IGL01662:Sorbs2	APN	8	45803829	splice site	probably benign
IGL01970:Sorbs2	APN	8	45745803	missense	probably damaging	1.00
IGL02169:Sorbs2	APN	8	45823749	missense	probably damaging	0.98
IGL02685:Sorbs2	APN	8	45803840	missense	probably benign	0.00
IGL03036:Sorbs2	APN	8	45782865	missense	probably benign
IGL03151:Sorbs2	APN	8	45799713	missense	probably benign	0.01
IGL03164:Sorbs2	APN	8	45782874	missense	probably benign	0.01
IGL03350:Sorbs2	APN	8	45805807	missense	probably damaging	0.99
BB001:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
BB011:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
R0058:Sorbs2	UTSW	8	45785254	splice site	probably null
R0058:Sorbs2	UTSW	8	45796263	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0265:Sorbs2	UTSW	8	45785337	splice site	probably benign
R0306:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R0308:Sorbs2	UTSW	8	45795130	nonsense	probably null
R0638:Sorbs2	UTSW	8	45796310	missense	probably damaging	1.00
R0940:Sorbs2	UTSW	8	45796502	missense	probably benign	0.39
R1160:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1226:Sorbs2	UTSW	8	45795619	missense	probably damaging	1.00
R1271:Sorbs2	UTSW	8	45795967	missense	probably damaging	1.00
R1440:Sorbs2	UTSW	8	45789963	splice site	probably benign
R1514:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R1557:Sorbs2	UTSW	8	45759197	splice site	probably benign
R1582:Sorbs2	UTSW	8	45805777	missense	probably damaging	0.99
R1626:Sorbs2	UTSW	8	45769854	missense	probably damaging	1.00
R1700:Sorbs2	UTSW	8	45800984	missense	probably damaging	1.00
R1759:Sorbs2	UTSW	8	45763019	makesense	probably null
R1766:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1782:Sorbs2	UTSW	8	45805696	missense	probably damaging	1.00
R1932:Sorbs2	UTSW	8	45796352	missense	probably benign	0.01
R1954:Sorbs2	UTSW	8	45745738	missense	probably benign	0.23
R2060:Sorbs2	UTSW	8	45775629	missense	probably damaging	1.00
R2149:Sorbs2	UTSW	8	45795443	missense	probably damaging	0.99
R2568:Sorbs2	UTSW	8	45795370	nonsense	probably null
R3812:Sorbs2	UTSW	8	45763030	missense	probably benign	0.00
R3831:Sorbs2	UTSW	8	45795095	missense	probably damaging	1.00
R3975:Sorbs2	UTSW	8	45772710	critical splice donor site	probably null
R4033:Sorbs2	UTSW	8	45775595	missense	probably damaging	1.00
R4714:Sorbs2	UTSW	8	45795293	missense	possibly damaging	0.89
R4828:Sorbs2	UTSW	8	45741615	intron	probably benign
R4926:Sorbs2	UTSW	8	45796217	missense	probably benign	0.03
R5027:Sorbs2	UTSW	8	45746534	splice site	probably null
R5118:Sorbs2	UTSW	8	45795785	missense	probably damaging	1.00
R5159:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R5342:Sorbs2	UTSW	8	45796013	missense	probably damaging	0.96
R5390:Sorbs2	UTSW	8	45819741	missense	probably damaging	1.00
R5436:Sorbs2	UTSW	8	45796001	missense	probably damaging	1.00
R5655:Sorbs2	UTSW	8	45741581	critical splice donor site	probably null
R5687:Sorbs2	UTSW	8	45775632	missense	probably damaging	1.00
R5695:Sorbs2	UTSW	8	45792875	missense	probably benign	0.27
R5733:Sorbs2	UTSW	8	45759189	missense	probably damaging	1.00
R5928:Sorbs2	UTSW	8	45763183	missense	probably damaging	1.00
R5949:Sorbs2	UTSW	8	45769897	critical splice donor site	probably null
R6341:Sorbs2	UTSW	8	45770578	missense	probably damaging	1.00
R6620:Sorbs2	UTSW	8	45796176	missense	probably damaging	1.00
R6761:Sorbs2	UTSW	8	45772614	missense	probably damaging	1.00
R7349:Sorbs2	UTSW	8	45795823	nonsense	probably null
R7404:Sorbs2	UTSW	8	45759196	splice site	probably null
R7524:Sorbs2	UTSW	8	45795656	missense	probably benign	0.00
R7809:Sorbs2	UTSW	8	45745428	missense	possibly damaging	0.93
R7820:Sorbs2	UTSW	8	45796556	missense	probably null	0.16
R7924:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
R8285:Sorbs2	UTSW	8	45796067	missense	probably damaging	0.98
R8696:Sorbs2	UTSW	8	45795649	missense	possibly damaging	0.95
R8928:Sorbs2	UTSW	8	45795915	missense	probably damaging	1.00
Z1176:Sorbs2	UTSW	8	45790025	missense	probably null	0.96
Z1177:Sorbs2	UTSW	8	45782959	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGTCATTTGCTCGGTGAAATCCAG -3'
(R):5'- AAAGGACGACCCTTCGACGTGAAC -3'

Sequencing Primer
(F):5'- GATGGAGCCAGTCTTCCAC -3'
(R):5'- CCTTCGACGTGAACGTAGTC -3'

Posted On

2014-01-05