Incidental Mutation 'R1018:Ankrd36'
ID96628
Institutional Source Beutler Lab
Gene Symbol Ankrd36
Ensembl Gene ENSMUSG00000020481
Gene Nameankyrin repeat domain 36
Synonyms1700012M14Rik, 1700008J08Rik, GC3
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1018 (G1)
Quality Score178
Status Validated
Chromosome11
Chromosomal Location5569684-5689337 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 5646876 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109856] [ENSMUST00000118112] [ENSMUST00000137933]
Predicted Effect probably benign
Transcript: ENSMUST00000109856
SMART Domains Protein: ENSMUSP00000105482
Gene: ENSMUSG00000020481

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 4.5e-3 SMART
ANK 99 128 1.44e-1 SMART
ANK 132 161 4.6e0 SMART
ANK 165 194 2.48e-5 SMART
ANK 198 227 4.67e-1 SMART
internal_repeat_1 449 555 1.04e-5 PROSPERO
internal_repeat_1 891 981 1.04e-5 PROSPERO
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1268 1297 N/A INTRINSIC
coiled coil region 1318 1338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118112
SMART Domains Protein: ENSMUSP00000122397
Gene: ENSMUSG00000020481

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 2.9e-5 SMART
ANK 99 128 9.4e-4 SMART
ANK 132 161 2.9e-2 SMART
ANK 165 194 1.5e-7 SMART
ANK 198 227 2.9e-3 SMART
internal_repeat_1 255 352 8.15e-5 PROSPERO
internal_repeat_1 438 538 8.15e-5 PROSPERO
low complexity region 1138 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137933
SMART Domains Protein: ENSMUSP00000120499
Gene: ENSMUSG00000020481

DomainStartEndE-ValueType
low complexity region 463 476 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Ankrd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ankrd36 APN 11 5620131 missense probably benign 0.01
IGL01361:Ankrd36 APN 11 5596706 splice site probably benign
IGL01370:Ankrd36 APN 11 5584019 missense probably benign 0.06
IGL01384:Ankrd36 APN 11 5628348 missense probably benign 0.33
IGL01484:Ankrd36 APN 11 5629006 missense possibly damaging 0.90
IGL01524:Ankrd36 APN 11 5635092 missense probably benign
IGL01700:Ankrd36 APN 11 5632198 missense probably benign 0.05
IGL02322:Ankrd36 APN 11 5614619 missense possibly damaging 0.86
IGL02511:Ankrd36 APN 11 5660845 unclassified probably null
IGL02824:Ankrd36 APN 11 5574246 missense possibly damaging 0.67
IGL03204:Ankrd36 APN 11 5584023 missense possibly damaging 0.70
PIT4508001:Ankrd36 UTSW 11 5607137 missense possibly damaging 0.53
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0304:Ankrd36 UTSW 11 5628981 missense possibly damaging 0.55
R0504:Ankrd36 UTSW 11 5629274 missense probably damaging 0.99
R0550:Ankrd36 UTSW 11 5607429 critical splice donor site probably null
R0563:Ankrd36 UTSW 11 5629322 missense probably benign 0.33
R0891:Ankrd36 UTSW 11 5687316 missense possibly damaging 0.72
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1558:Ankrd36 UTSW 11 5635329 missense probably damaging 0.99
R1663:Ankrd36 UTSW 11 5620126 missense possibly damaging 0.70
R1682:Ankrd36 UTSW 11 5607143 missense possibly damaging 0.84
R1898:Ankrd36 UTSW 11 5575683 missense probably benign 0.33
R2019:Ankrd36 UTSW 11 5689140 missense probably benign
R2032:Ankrd36 UTSW 11 5628616 missense possibly damaging 0.86
R2084:Ankrd36 UTSW 11 5662378 nonsense probably null
R4097:Ankrd36 UTSW 11 5628703 missense possibly damaging 0.85
R4572:Ankrd36 UTSW 11 5689340 unclassified probably null
R4601:Ankrd36 UTSW 11 5570102 missense probably benign 0.04
R4770:Ankrd36 UTSW 11 5590870 missense possibly damaging 0.73
R4777:Ankrd36 UTSW 11 5607120 missense probably benign
R4894:Ankrd36 UTSW 11 5635332 missense probably damaging 0.98
R5288:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5366:Ankrd36 UTSW 11 5592841 nonsense probably null
R5384:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5385:Ankrd36 UTSW 11 5689340 unclassified probably benign
R6109:Ankrd36 UTSW 11 5628941 missense probably damaging 0.98
R6155:Ankrd36 UTSW 11 5687442 missense probably benign 0.00
R6186:Ankrd36 UTSW 11 5643812 missense possibly damaging 0.81
R6289:Ankrd36 UTSW 11 5628837 missense probably damaging 0.96
R6476:Ankrd36 UTSW 11 5628753 missense probably benign 0.05
R6816:Ankrd36 UTSW 11 5643765 missense possibly damaging 0.66
R6880:Ankrd36 UTSW 11 5628748 missense probably damaging 0.99
R6919:Ankrd36 UTSW 11 5629299 missense probably benign
R7007:Ankrd36 UTSW 11 5689168 missense probably benign 0.00
R7515:Ankrd36 UTSW 11 5628905 missense possibly damaging 0.94
R7617:Ankrd36 UTSW 11 5687348 missense probably benign 0.33
R7684:Ankrd36 UTSW 11 5570113 missense possibly damaging 0.49
R7746:Ankrd36 UTSW 11 5687451 missense possibly damaging 0.96
R7783:Ankrd36 UTSW 11 5635359 missense probably damaging 0.99
R7790:Ankrd36 UTSW 11 5635176 missense possibly damaging 0.80
RF004:Ankrd36 UTSW 11 5662411 missense possibly damaging 0.53
U24488:Ankrd36 UTSW 11 5630772 missense probably damaging 0.99
Z1176:Ankrd36 UTSW 11 5615538 missense probably benign
Z1177:Ankrd36 UTSW 11 5571117 missense probably damaging 0.97
Z1177:Ankrd36 UTSW 11 5629345 missense probably benign 0.01
Z1177:Ankrd36 UTSW 11 5643738 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAATAAACAGGAGGTGTTGACTGGGGTA -3'
(R):5'- GAACCTGAACTCTTCCACGTTCTGTGA -3'

Sequencing Primer
(F):5'- CACCACTTCTGTGCATTTACTGC -3'
(R):5'- CCACGTTCTGTGACTCGG -3'
Posted On2014-01-05