Incidental Mutation 'R1018:Epx'
List |< first << previous [record 12 of 48] next >> last >|
ID96635
Institutional Source Beutler Lab
Gene Symbol Epx
Ensembl Gene ENSMUSG00000052234
Gene Nameeosinophil peroxidase
SynonymsEPO
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87864000-87875536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87869303 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 495 (N495S)
Ref Sequence ENSEMBL: ENSMUSP00000050497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049768]
Predicted Effect probably benign
Transcript: ENSMUST00000049768
AA Change: N495S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000050497
Gene: ENSMUSG00000052234
AA Change: N495S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 146 690 8.3e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125590
Meta Mutation Damage Score 0.1868 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a member of the peroxidase superfamily of enzymes that is produced by eosinophils and plays a critical role in eliminating tissue-invasive parasites. The encoded preproprotein undergoes proteolytic processing to generate a heterodimeric enzyme that forms a predominant component of the intracellular granules of eosinophils. Mice lacking the encoded protein exhibit resistance to ulcerative colitis induced by dextran sulfate. [provided by RefSeq, Jul 2016]
PHENOTYPE: Targeted deletion of this gene results in ultrastructural changes of the eosinophil secondary granule but does not significantly alter the course of inflammation or development of allergic pulmonary pathologies in an ovalbumin-challenge model of pulmonary inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Epx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Epx APN 11 87869925 missense probably damaging 1.00
IGL01723:Epx APN 11 87869402 missense probably damaging 1.00
IGL02096:Epx APN 11 87869468 missense probably damaging 1.00
IGL02423:Epx APN 11 87871318 missense possibly damaging 0.85
K7371:Epx UTSW 11 87864884 missense probably damaging 1.00
R1607:Epx UTSW 11 87868712 missense probably damaging 1.00
R2017:Epx UTSW 11 87874337 missense probably damaging 1.00
R2030:Epx UTSW 11 87864824 missense probably damaging 1.00
R3838:Epx UTSW 11 87874830 missense probably damaging 1.00
R4417:Epx UTSW 11 87869430 nonsense probably null
R5083:Epx UTSW 11 87872680 missense probably damaging 0.99
R5712:Epx UTSW 11 87874853 nonsense probably null
R5935:Epx UTSW 11 87865492 missense probably damaging 1.00
R6830:Epx UTSW 11 87868626 missense probably damaging 1.00
R6857:Epx UTSW 11 87869955 nonsense probably null
R6984:Epx UTSW 11 87868598 missense probably damaging 1.00
R7031:Epx UTSW 11 87875523 start gained probably benign
R7652:Epx UTSW 11 87875334 critical splice donor site probably null
R7667:Epx UTSW 11 87874311 missense probably damaging 0.98
R8313:Epx UTSW 11 87872731 missense possibly damaging 0.71
X0065:Epx UTSW 11 87865475 missense probably benign 0.03
Z1177:Epx UTSW 11 87869261 missense probably damaging 1.00
Z1177:Epx UTSW 11 87869894 missense possibly damaging 0.56
Z1177:Epx UTSW 11 87872767 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGAGAGACTCACTGATGGCTGC -3'
(R):5'- TCCAATGGGAGATTAATGCTGCCAC -3'

Sequencing Primer
(F):5'- CCATCTTTCCACTATCCTGAGAAG -3'
(R):5'- GGAGATTAATGCTGCCACACTTG -3'
Posted On2014-01-05