Incidental Mutation 'R1018:Zfp957'
ID96656
Institutional Source Beutler Lab
Gene Symbol Zfp957
Ensembl Gene ENSMUSG00000071262
Gene Namezinc finger protein 957
SynonymsAU017455
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location79212355-79247369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79212742 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 539 (C539F)
Ref Sequence ENSEMBL: ENSMUSP00000124930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040802] [ENSMUST00000161649]
Predicted Effect probably damaging
Transcript: ENSMUST00000040802
AA Change: C539F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039470
Gene: ENSMUSG00000071262
AA Change: C539F

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 29 53 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
AT_hook 255 267 4.76e0 SMART
AT_hook 298 310 4.76e0 SMART
AT_hook 348 360 2.48e0 SMART
low complexity region 390 398 N/A INTRINSIC
AT_hook 422 434 5.38e0 SMART
PHD 507 554 1.18e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161649
AA Change: C539F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124930
Gene: ENSMUSG00000071262
AA Change: C539F

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 29 53 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
AT_hook 255 267 4.76e0 SMART
AT_hook 298 310 4.76e0 SMART
AT_hook 348 360 2.48e0 SMART
low complexity region 390 398 N/A INTRINSIC
AT_hook 422 434 5.38e0 SMART
PHD 507 554 1.18e-6 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Other mutations in Zfp957
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfp957 APN 14 79213398 missense unknown
IGL01646:Zfp957 APN 14 79213891 missense probably benign 0.00
IGL02692:Zfp957 APN 14 79213385 missense unknown
R0632:Zfp957 UTSW 14 79212920 missense probably damaging 1.00
R1719:Zfp957 UTSW 14 79213996 missense probably damaging 1.00
R2165:Zfp957 UTSW 14 79213613 missense probably benign 0.06
R2411:Zfp957 UTSW 14 79214342 missense unknown
R2517:Zfp957 UTSW 14 79214054 missense probably damaging 0.99
R3195:Zfp957 UTSW 14 79212892 missense probably damaging 1.00
R4825:Zfp957 UTSW 14 79214356 start codon destroyed probably null
R4881:Zfp957 UTSW 14 79213409 missense unknown
R5138:Zfp957 UTSW 14 79212922 missense probably damaging 1.00
R5174:Zfp957 UTSW 14 79213388 missense unknown
R5531:Zfp957 UTSW 14 79213182 missense unknown
R5547:Zfp957 UTSW 14 79213966 missense probably benign 0.03
R5677:Zfp957 UTSW 14 79212767 missense probably damaging 1.00
R5968:Zfp957 UTSW 14 79214056 missense probably damaging 1.00
R6897:Zfp957 UTSW 14 79213904 missense probably damaging 0.98
R6994:Zfp957 UTSW 14 79213690 missense probably damaging 0.99
R7105:Zfp957 UTSW 14 79212962 missense probably benign 0.09
R7214:Zfp957 UTSW 14 79213310 missense unknown
R7264:Zfp957 UTSW 14 79213640 missense probably damaging 0.98
Z1176:Zfp957 UTSW 14 79214138 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTCACCAGTTTGAGTGTGACCTGAG -3'
(R):5'- GGGAGTTACAAATCCCTGAACGACC -3'

Sequencing Primer
(F):5'- TTTGAGTGTGACCTGAGAACATAG -3'
(R):5'- CCAGCAACGAATTTTGGGTC -3'
Posted On2014-01-05