Incidental Mutation 'R1018:Zfp957'
ID 96656
Institutional Source Beutler Lab
Gene Symbol Zfp957
Ensembl Gene ENSMUSG00000071262
Gene Name zinc finger protein 957
Synonyms AU017455
MMRRC Submission 039122-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.454) question?
Stock # R1018 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 79449795-79484807 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 79450182 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 539 (C539F)
Ref Sequence ENSEMBL: ENSMUSP00000124930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040802] [ENSMUST00000161649]
AlphaFold Q3UT76
Predicted Effect probably damaging
Transcript: ENSMUST00000040802
AA Change: C539F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039470
Gene: ENSMUSG00000071262
AA Change: C539F

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 29 53 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
AT_hook 255 267 4.76e0 SMART
AT_hook 298 310 4.76e0 SMART
AT_hook 348 360 2.48e0 SMART
low complexity region 390 398 N/A INTRINSIC
AT_hook 422 434 5.38e0 SMART
PHD 507 554 1.18e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161649
AA Change: C539F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124930
Gene: ENSMUSG00000071262
AA Change: C539F

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 29 53 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
AT_hook 255 267 4.76e0 SMART
AT_hook 298 310 4.76e0 SMART
AT_hook 348 360 2.48e0 SMART
low complexity region 390 398 N/A INTRINSIC
AT_hook 422 434 5.38e0 SMART
PHD 507 554 1.18e-6 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,837,325 (GRCm39) C403F probably damaging Het
Adam20 C T 8: 41,249,146 (GRCm39) Q419* probably null Het
Ankrd36 C T 11: 5,596,876 (GRCm39) probably benign Het
Arl8b T A 6: 108,795,572 (GRCm39) I170K probably damaging Het
Atp5pb A T 3: 105,861,488 (GRCm39) V78E possibly damaging Het
Car9 G T 4: 43,512,439 (GRCm39) probably null Het
Cgnl1 A G 9: 71,633,340 (GRCm39) Y4H probably damaging Het
Cnn2 T C 10: 79,829,397 (GRCm39) C176R probably damaging Het
Dst A G 1: 34,233,174 (GRCm39) D3392G probably damaging Het
Eed T C 7: 89,617,019 (GRCm39) probably benign Het
Efl1 T A 7: 82,412,221 (GRCm39) V870E possibly damaging Het
Epx T C 11: 87,760,129 (GRCm39) N495S probably benign Het
Fbxw20 T A 9: 109,050,404 (GRCm39) Y407F probably benign Het
Gbp9 T A 5: 105,228,126 (GRCm39) Q552L probably benign Het
Hspa13 C A 16: 75,558,164 (GRCm39) V134L possibly damaging Het
Il16 T C 7: 83,323,746 (GRCm39) N268S probably damaging Het
Kif14 G A 1: 136,423,579 (GRCm39) probably benign Het
Lrig1 G A 6: 94,599,583 (GRCm39) probably benign Het
Myo7a T A 7: 97,756,212 (GRCm39) D29V probably damaging Het
Nsd2 A G 5: 34,000,585 (GRCm39) K34R probably damaging Het
Or4a15 C A 2: 89,193,523 (GRCm39) L83F possibly damaging Het
P3h1 C A 4: 119,095,104 (GRCm39) T287K probably damaging Het
Pkhd1 A T 1: 20,271,483 (GRCm39) H3023Q possibly damaging Het
Plxna1 A G 6: 89,319,942 (GRCm39) L535P probably damaging Het
Prom1 A T 5: 44,187,056 (GRCm39) S400R probably benign Het
Psap T G 10: 60,136,590 (GRCm39) L523R probably damaging Het
Psme4 C T 11: 30,754,310 (GRCm39) T189I probably damaging Het
Ptpn12 A T 5: 21,234,867 (GRCm39) S39T possibly damaging Het
Qtrt2 T A 16: 43,698,363 (GRCm39) H98L possibly damaging Het
Rad54l2 C A 9: 106,589,589 (GRCm39) C601F probably benign Het
Saxo4 A T 19: 10,456,824 (GRCm39) probably benign Het
Sfswap A G 5: 129,631,640 (GRCm39) K756R possibly damaging Het
Slc24a5 T C 2: 124,910,827 (GRCm39) V86A probably damaging Het
Srrm2 T C 17: 24,041,514 (GRCm39) S2575P probably damaging Het
Stam T C 2: 14,122,185 (GRCm39) probably benign Het
Tbx6 T A 7: 126,382,364 (GRCm39) probably benign Het
Tmem131 A C 1: 36,833,900 (GRCm39) F1727V probably damaging Het
Tpr T A 1: 150,317,934 (GRCm39) H2147Q possibly damaging Het
Trio T A 15: 27,871,257 (GRCm39) H620L probably damaging Het
Uba5 T C 9: 103,927,102 (GRCm39) T292A probably benign Het
Unc5a T A 13: 55,138,765 (GRCm39) V48E possibly damaging Het
Upf1 G T 8: 70,791,556 (GRCm39) H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 (GRCm39) probably benign Het
Vmn2r6 T A 3: 64,464,261 (GRCm39) D191V probably benign Het
Wapl T C 14: 34,413,863 (GRCm39) Y242H possibly damaging Het
Zfp341 A T 2: 154,487,972 (GRCm39) N812Y probably damaging Het
Zfp358 C A 8: 3,546,843 (GRCm39) S475* probably null Het
Other mutations in Zfp957
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfp957 APN 14 79,450,838 (GRCm39) missense unknown
IGL01646:Zfp957 APN 14 79,451,331 (GRCm39) missense probably benign 0.00
IGL02692:Zfp957 APN 14 79,450,825 (GRCm39) missense unknown
R0632:Zfp957 UTSW 14 79,450,360 (GRCm39) missense probably damaging 1.00
R1719:Zfp957 UTSW 14 79,451,436 (GRCm39) missense probably damaging 1.00
R2165:Zfp957 UTSW 14 79,451,053 (GRCm39) missense probably benign 0.06
R2411:Zfp957 UTSW 14 79,451,782 (GRCm39) missense unknown
R2517:Zfp957 UTSW 14 79,451,494 (GRCm39) missense probably damaging 0.99
R3195:Zfp957 UTSW 14 79,450,332 (GRCm39) missense probably damaging 1.00
R4825:Zfp957 UTSW 14 79,451,796 (GRCm39) start codon destroyed probably null
R4881:Zfp957 UTSW 14 79,450,849 (GRCm39) missense unknown
R5138:Zfp957 UTSW 14 79,450,362 (GRCm39) missense probably damaging 1.00
R5174:Zfp957 UTSW 14 79,450,828 (GRCm39) missense unknown
R5531:Zfp957 UTSW 14 79,450,622 (GRCm39) missense unknown
R5547:Zfp957 UTSW 14 79,451,406 (GRCm39) missense probably benign 0.03
R5677:Zfp957 UTSW 14 79,450,207 (GRCm39) missense probably damaging 1.00
R5968:Zfp957 UTSW 14 79,451,496 (GRCm39) missense probably damaging 1.00
R6897:Zfp957 UTSW 14 79,451,344 (GRCm39) missense probably damaging 0.98
R6994:Zfp957 UTSW 14 79,451,130 (GRCm39) missense probably damaging 0.99
R7105:Zfp957 UTSW 14 79,450,402 (GRCm39) missense probably benign 0.09
R7214:Zfp957 UTSW 14 79,450,750 (GRCm39) missense unknown
R7264:Zfp957 UTSW 14 79,451,080 (GRCm39) missense probably damaging 0.98
R8407:Zfp957 UTSW 14 79,451,352 (GRCm39) missense possibly damaging 0.91
R8549:Zfp957 UTSW 14 79,451,346 (GRCm39) missense probably damaging 1.00
Z1176:Zfp957 UTSW 14 79,451,578 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTCACCAGTTTGAGTGTGACCTGAG -3'
(R):5'- GGGAGTTACAAATCCCTGAACGACC -3'

Sequencing Primer
(F):5'- TTTGAGTGTGACCTGAGAACATAG -3'
(R):5'- CCAGCAACGAATTTTGGGTC -3'
Posted On 2014-01-05