Incidental Mutation 'R1110:Cdk17'
ID96657
Institutional Source Beutler Lab
Gene Symbol Cdk17
Ensembl Gene ENSMUSG00000020015
Gene Namecyclin-dependent kinase 17
SynonymsPctk2, 6430598J10Rik
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R1110 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93160875-93267071 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 93239033 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 3 (Y3*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069965] [ENSMUST00000215286]
Predicted Effect probably null
Transcript: ENSMUST00000069965
AA Change: Y508*
SMART Domains Protein: ENSMUSP00000070355
Gene: ENSMUSG00000020015
AA Change: Y508*

DomainStartEndE-ValueType
S_TKc 192 473 4.67e-97 SMART
Predicted Effect probably null
Transcript: ENSMUST00000215286
AA Change: Y475*
Predicted Effect probably null
Transcript: ENSMUST00000216729
AA Change: Y3*
Meta Mutation Damage Score 0.9702 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cdc2/cdkx subfamily of the ser/thr family of protein kinases. It has similarity to a rat protein that is thought to play a role in terminally differentiated neurons. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Fbxl13 T C 5: 21,484,036 D758G probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pibf1 C T 14: 99,112,973 R186C probably damaging Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Samd9l T A 6: 3,374,267 D998V probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Urgcp T C 11: 5,716,004 N778S probably benign Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Cdk17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Cdk17 APN 10 93226771 missense probably damaging 1.00
IGL00781:Cdk17 APN 10 93232416 missense probably damaging 1.00
IGL01622:Cdk17 APN 10 93238962 unclassified probably benign
IGL01623:Cdk17 APN 10 93238962 unclassified probably benign
IGL01732:Cdk17 APN 10 93218045 missense probably benign 0.01
IGL01768:Cdk17 APN 10 93208261 missense probably damaging 0.99
IGL02942:Cdk17 APN 10 93238968 missense probably benign
IGL03308:Cdk17 APN 10 93221644 critical splice donor site probably null
Magician UTSW 10 93228703 missense probably damaging 1.00
R1924_Cdk17_292 UTSW 10 93226117 missense probably damaging 1.00
R4436_Cdk17_536 UTSW 10 93211896 splice site probably null
R0039:Cdk17 UTSW 10 93226778 splice site probably benign
R0398:Cdk17 UTSW 10 93237840 missense probably benign 0.01
R0432:Cdk17 UTSW 10 93237790 unclassified probably benign
R0609:Cdk17 UTSW 10 93216472 missense probably benign
R0781:Cdk17 UTSW 10 93239033 nonsense probably null
R1604:Cdk17 UTSW 10 93232498 missense probably damaging 1.00
R1674:Cdk17 UTSW 10 93221630 missense probably benign 0.21
R1758:Cdk17 UTSW 10 93208250 missense probably damaging 1.00
R1797:Cdk17 UTSW 10 93208252 missense possibly damaging 0.76
R1864:Cdk17 UTSW 10 93226105 missense probably damaging 1.00
R1924:Cdk17 UTSW 10 93226117 missense probably damaging 1.00
R1929:Cdk17 UTSW 10 93228678 missense probably damaging 1.00
R2143:Cdk17 UTSW 10 93218019 missense probably damaging 1.00
R2207:Cdk17 UTSW 10 93228762 missense probably damaging 1.00
R2261:Cdk17 UTSW 10 93211958 missense possibly damaging 0.90
R2262:Cdk17 UTSW 10 93211958 missense possibly damaging 0.90
R3737:Cdk17 UTSW 10 93221644 critical splice donor site probably null
R3883:Cdk17 UTSW 10 93212077 critical splice donor site probably null
R4436:Cdk17 UTSW 10 93211896 splice site probably null
R5372:Cdk17 UTSW 10 93226039 missense probably benign 0.03
R5444:Cdk17 UTSW 10 93217961 splice site probably null
R5488:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R5489:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R5815:Cdk17 UTSW 10 93228697 missense probably damaging 1.00
R6164:Cdk17 UTSW 10 93235469 missense probably benign 0.26
R6209:Cdk17 UTSW 10 93208231 missense probably benign 0.05
R6384:Cdk17 UTSW 10 93211965 missense probably damaging 0.99
R6627:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R6698:Cdk17 UTSW 10 93228678 missense probably damaging 1.00
R7164:Cdk17 UTSW 10 93232481 missense probably benign 0.07
R8096:Cdk17 UTSW 10 93216367 missense probably damaging 0.98
R8118:Cdk17 UTSW 10 93216390 missense possibly damaging 0.46
R8459:Cdk17 UTSW 10 93232427 missense probably damaging 0.99
R8670:Cdk17 UTSW 10 93226096 nonsense probably null
R8722:Cdk17 UTSW 10 93228703 missense probably damaging 1.00
R8829:Cdk17 UTSW 10 93207058 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTCTTAACTGAGGGCTGCGGAAC -3'
(R):5'- ACATACAGAGTTGTGGGATGCACTG -3'

Sequencing Primer
(F):5'- CAAGACTTCTCGCGTAGAATTTGG -3'
(R):5'- GTGGGATGCACTGTACATTG -3'
Posted On2014-01-05