Incidental Mutation 'R1110:Olfr824'
ID96664
Institutional Source Beutler Lab
Gene Symbol Olfr824
Ensembl Gene ENSMUSG00000095804
Gene Nameolfactory receptor 824
SynonymsGA_x6K02T2PULF-11797746-11796799, MOR210-3
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1110 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location130123470-130130000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130126653 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 135 (Y135H)
Ref Sequence ENSEMBL: ENSMUSP00000150662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074161] [ENSMUST00000214192] [ENSMUST00000215217]
Predicted Effect probably damaging
Transcript: ENSMUST00000074161
AA Change: Y135H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073794
Gene: ENSMUSG00000095804
AA Change: Y135H

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4.6e-54 PFAM
Pfam:7tm_1 44 293 3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214192
AA Change: Y135H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215217
AA Change: Y135H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Fbxl13 T C 5: 21,484,036 D758G probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pibf1 C T 14: 99,112,973 R186C probably damaging Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Samd9l T A 6: 3,374,267 D998V probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Urgcp T C 11: 5,716,004 N778S probably benign Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Olfr824
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Olfr824 APN 10 130126991 missense probably benign 0.45
IGL02391:Olfr824 APN 10 130126904 missense possibly damaging 0.75
IGL03247:Olfr824 APN 10 130126715 missense probably damaging 1.00
R0781:Olfr824 UTSW 10 130126653 missense probably damaging 1.00
R1694:Olfr824 UTSW 10 130126254 missense possibly damaging 0.93
R2069:Olfr824 UTSW 10 130126205 missense possibly damaging 0.94
R2173:Olfr824 UTSW 10 130126503 missense probably benign 0.10
R4078:Olfr824 UTSW 10 130126718 missense probably damaging 1.00
R4864:Olfr824 UTSW 10 130126887 nonsense probably null
R5556:Olfr824 UTSW 10 130126859 missense probably damaging 1.00
R6704:Olfr824 UTSW 10 130126155 nonsense probably null
R7624:Olfr824 UTSW 10 130126586 missense probably damaging 0.98
R8013:Olfr824 UTSW 10 130126778 missense probably damaging 1.00
R8049:Olfr824 UTSW 10 130126600 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCAGGCTGAGCATACATGAAGAAC -3'
(R):5'- GCAGAGCAGGAACTATACTGAGCTG -3'

Sequencing Primer
(F):5'- CCACATGTAGAGAAGGTTTTACTCC -3'
(R):5'- ACTGAGCTGACAGACTTTATCCTG -3'
Posted On2014-01-05