Incidental Mutation 'R1018:Hspa13'
ID96665
Institutional Source Beutler Lab
Gene Symbol Hspa13
Ensembl Gene ENSMUSG00000032932
Gene Nameheat shock protein 70 family, member 13
Synonyms1600002I10Rik, Stch, 60kDa, B230217N24Rik
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.593) question?
Stock #R1018 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location75745431-75767104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75761276 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 134 (V134L)
Ref Sequence ENSEMBL: ENSMUSP00000048817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046283] [ENSMUST00000114244] [ENSMUST00000232633]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046283
AA Change: V134L

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048817
Gene: ENSMUSG00000032932
AA Change: V134L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HSP70 33 347 3.4e-79 PFAM
Pfam:HSP70 349 460 5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114244
AA Change: V134L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109882
Gene: ENSMUSG00000032932
AA Change: V134L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HSP70 33 260 1.2e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174952
Predicted Effect probably benign
Transcript: ENSMUST00000232633
AA Change: V134L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The encoded protein contains an ATPase domain and has been shown to associate with a ubiquitin-like protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Ppp1r32 A T 19: 10,479,460 probably benign Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Hspa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Hspa13 APN 16 75757992 missense possibly damaging 0.86
IGL03350:Hspa13 APN 16 75757829 missense probably damaging 1.00
R0329:Hspa13 UTSW 16 75765130 missense probably damaging 1.00
R1029:Hspa13 UTSW 16 75765237 missense probably damaging 1.00
R2043:Hspa13 UTSW 16 75758268 missense probably benign 0.01
R3404:Hspa13 UTSW 16 75758026 nonsense probably null
R3766:Hspa13 UTSW 16 75765086 missense probably benign 0.00
R4596:Hspa13 UTSW 16 75758226 missense probably benign 0.01
R4610:Hspa13 UTSW 16 75761302 missense probably benign 0.02
R4839:Hspa13 UTSW 16 75765281 missense probably damaging 1.00
R5621:Hspa13 UTSW 16 75766763 utr 5 prime probably benign
R5782:Hspa13 UTSW 16 75758097 missense probably damaging 1.00
R6428:Hspa13 UTSW 16 75757986 missense probably damaging 1.00
R6597:Hspa13 UTSW 16 75765197 missense probably damaging 1.00
R6746:Hspa13 UTSW 16 75765037 missense possibly damaging 0.89
R6903:Hspa13 UTSW 16 75757984 missense probably damaging 1.00
Z1088:Hspa13 UTSW 16 75758185 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTATTACCAGCAAGGTTGGCAG -3'
(R):5'- ACGCATCCTTCCAATGAGAATGCAC -3'

Sequencing Primer
(F):5'- GCAAGGTTGGCAGCTTGG -3'
(R):5'- GGCTCTTCCTGAAAACTGTAAC -3'
Posted On2014-01-05