Incidental Mutation 'R1018:Hspa13'
ID 96665
Institutional Source Beutler Lab
Gene Symbol Hspa13
Ensembl Gene ENSMUSG00000032932
Gene Name heat shock protein 70 family, member 13
Synonyms Stch, B230217N24Rik, 60kDa, 1600002I10Rik
MMRRC Submission 039122-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.714) question?
Stock # R1018 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 75552078-75564575 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 75558164 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 134 (V134L)
Ref Sequence ENSEMBL: ENSMUSP00000048817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046283] [ENSMUST00000114244] [ENSMUST00000232633]
AlphaFold Q8BM72
Predicted Effect possibly damaging
Transcript: ENSMUST00000046283
AA Change: V134L

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048817
Gene: ENSMUSG00000032932
AA Change: V134L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HSP70 33 347 3.4e-79 PFAM
Pfam:HSP70 349 460 5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114244
AA Change: V134L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109882
Gene: ENSMUSG00000032932
AA Change: V134L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:HSP70 33 260 1.2e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174952
Predicted Effect probably benign
Transcript: ENSMUST00000232633
AA Change: V134L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The encoded protein contains an ATPase domain and has been shown to associate with a ubiquitin-like protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,837,325 (GRCm39) C403F probably damaging Het
Adam20 C T 8: 41,249,146 (GRCm39) Q419* probably null Het
Ankrd36 C T 11: 5,596,876 (GRCm39) probably benign Het
Arl8b T A 6: 108,795,572 (GRCm39) I170K probably damaging Het
Atp5pb A T 3: 105,861,488 (GRCm39) V78E possibly damaging Het
Car9 G T 4: 43,512,439 (GRCm39) probably null Het
Cgnl1 A G 9: 71,633,340 (GRCm39) Y4H probably damaging Het
Cnn2 T C 10: 79,829,397 (GRCm39) C176R probably damaging Het
Dst A G 1: 34,233,174 (GRCm39) D3392G probably damaging Het
Eed T C 7: 89,617,019 (GRCm39) probably benign Het
Efl1 T A 7: 82,412,221 (GRCm39) V870E possibly damaging Het
Epx T C 11: 87,760,129 (GRCm39) N495S probably benign Het
Fbxw20 T A 9: 109,050,404 (GRCm39) Y407F probably benign Het
Gbp9 T A 5: 105,228,126 (GRCm39) Q552L probably benign Het
Il16 T C 7: 83,323,746 (GRCm39) N268S probably damaging Het
Kif14 G A 1: 136,423,579 (GRCm39) probably benign Het
Lrig1 G A 6: 94,599,583 (GRCm39) probably benign Het
Myo7a T A 7: 97,756,212 (GRCm39) D29V probably damaging Het
Nsd2 A G 5: 34,000,585 (GRCm39) K34R probably damaging Het
Or4a15 C A 2: 89,193,523 (GRCm39) L83F possibly damaging Het
P3h1 C A 4: 119,095,104 (GRCm39) T287K probably damaging Het
Pkhd1 A T 1: 20,271,483 (GRCm39) H3023Q possibly damaging Het
Plxna1 A G 6: 89,319,942 (GRCm39) L535P probably damaging Het
Prom1 A T 5: 44,187,056 (GRCm39) S400R probably benign Het
Psap T G 10: 60,136,590 (GRCm39) L523R probably damaging Het
Psme4 C T 11: 30,754,310 (GRCm39) T189I probably damaging Het
Ptpn12 A T 5: 21,234,867 (GRCm39) S39T possibly damaging Het
Qtrt2 T A 16: 43,698,363 (GRCm39) H98L possibly damaging Het
Rad54l2 C A 9: 106,589,589 (GRCm39) C601F probably benign Het
Saxo4 A T 19: 10,456,824 (GRCm39) probably benign Het
Sfswap A G 5: 129,631,640 (GRCm39) K756R possibly damaging Het
Slc24a5 T C 2: 124,910,827 (GRCm39) V86A probably damaging Het
Srrm2 T C 17: 24,041,514 (GRCm39) S2575P probably damaging Het
Stam T C 2: 14,122,185 (GRCm39) probably benign Het
Tbx6 T A 7: 126,382,364 (GRCm39) probably benign Het
Tmem131 A C 1: 36,833,900 (GRCm39) F1727V probably damaging Het
Tpr T A 1: 150,317,934 (GRCm39) H2147Q possibly damaging Het
Trio T A 15: 27,871,257 (GRCm39) H620L probably damaging Het
Uba5 T C 9: 103,927,102 (GRCm39) T292A probably benign Het
Unc5a T A 13: 55,138,765 (GRCm39) V48E possibly damaging Het
Upf1 G T 8: 70,791,556 (GRCm39) H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 (GRCm39) probably benign Het
Vmn2r6 T A 3: 64,464,261 (GRCm39) D191V probably benign Het
Wapl T C 14: 34,413,863 (GRCm39) Y242H possibly damaging Het
Zfp341 A T 2: 154,487,972 (GRCm39) N812Y probably damaging Het
Zfp358 C A 8: 3,546,843 (GRCm39) S475* probably null Het
Zfp957 C A 14: 79,450,182 (GRCm39) C539F probably damaging Het
Other mutations in Hspa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Hspa13 APN 16 75,554,880 (GRCm39) missense possibly damaging 0.86
IGL03350:Hspa13 APN 16 75,554,717 (GRCm39) missense probably damaging 1.00
R0329:Hspa13 UTSW 16 75,562,018 (GRCm39) missense probably damaging 1.00
R1029:Hspa13 UTSW 16 75,562,125 (GRCm39) missense probably damaging 1.00
R2043:Hspa13 UTSW 16 75,555,156 (GRCm39) missense probably benign 0.01
R3404:Hspa13 UTSW 16 75,554,914 (GRCm39) nonsense probably null
R3766:Hspa13 UTSW 16 75,561,974 (GRCm39) missense probably benign 0.00
R4596:Hspa13 UTSW 16 75,555,114 (GRCm39) missense probably benign 0.01
R4610:Hspa13 UTSW 16 75,558,190 (GRCm39) missense probably benign 0.02
R4839:Hspa13 UTSW 16 75,562,169 (GRCm39) missense probably damaging 1.00
R5621:Hspa13 UTSW 16 75,563,651 (GRCm39) utr 5 prime probably benign
R5782:Hspa13 UTSW 16 75,554,985 (GRCm39) missense probably damaging 1.00
R6428:Hspa13 UTSW 16 75,554,874 (GRCm39) missense probably damaging 1.00
R6597:Hspa13 UTSW 16 75,562,085 (GRCm39) missense probably damaging 1.00
R6746:Hspa13 UTSW 16 75,561,925 (GRCm39) missense possibly damaging 0.89
R6903:Hspa13 UTSW 16 75,554,872 (GRCm39) missense probably damaging 1.00
Z1088:Hspa13 UTSW 16 75,555,073 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTATTACCAGCAAGGTTGGCAG -3'
(R):5'- ACGCATCCTTCCAATGAGAATGCAC -3'

Sequencing Primer
(F):5'- GCAAGGTTGGCAGCTTGG -3'
(R):5'- GGCTCTTCCTGAAAACTGTAAC -3'
Posted On 2014-01-05