Incidental Mutation 'R1110:Urgcp'
ID96666
Institutional Source Beutler Lab
Gene Symbol Urgcp
Ensembl Gene ENSMUSG00000049680
Gene Nameupregulator of cell proliferation
Synonyms
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R1110 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5713417-5762376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5716004 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 778 (N778S)
Ref Sequence ENSEMBL: ENSMUSP00000133216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053427] [ENSMUST00000093362] [ENSMUST00000118076] [ENSMUST00000120306] [ENSMUST00000140922] [ENSMUST00000170116]
Predicted Effect probably benign
Transcript: ENSMUST00000053427
AA Change: N778S

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000055821
Gene: ENSMUSG00000049680
AA Change: N778S

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093362
AA Change: N821S

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000091053
Gene: ENSMUSG00000049680
AA Change: N821S

DomainStartEndE-ValueType
Blast:PGAM 15 752 N/A BLAST
SCOP:d1h65a_ 670 761 1e-3 SMART
coiled coil region 899 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118076
AA Change: N778S

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113589
Gene: ENSMUSG00000049680
AA Change: N778S

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120306
AA Change: N778S

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113060
Gene: ENSMUSG00000049680
AA Change: N778S

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140922
SMART Domains Protein: ENSMUSP00000120902
Gene: ENSMUSG00000049680

DomainStartEndE-ValueType
Blast:PGAM 1 99 7e-43 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149980
Predicted Effect probably benign
Transcript: ENSMUST00000170116
AA Change: N778S

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133216
Gene: ENSMUSG00000049680
AA Change: N778S

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Meta Mutation Damage Score 0.6809 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] URG4 is upregulated in the presence of hepatitis B virus (HBV)-encoded X antigen (HBxAg) and may contribute to the development of hepatocellular carcinoma by promoting hepatocellular growth and survival (Tufan et al., 2002 [PubMed 12082552]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Fbxl13 T C 5: 21,484,036 D758G probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pibf1 C T 14: 99,112,973 R186C probably damaging Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Samd9l T A 6: 3,374,267 D998V probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Urgcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Urgcp APN 11 5716448 missense possibly damaging 0.94
IGL01832:Urgcp APN 11 5717325 missense probably damaging 0.99
IGL02299:Urgcp APN 11 5717573 missense probably damaging 1.00
IGL02519:Urgcp APN 11 5717745 missense probably benign 0.02
IGL02616:Urgcp APN 11 5717400 missense probably damaging 0.99
IGL02619:Urgcp APN 11 5715752 missense possibly damaging 0.87
IGL03135:Urgcp APN 11 5716091 missense possibly damaging 0.79
IGL03209:Urgcp APN 11 5717238 unclassified probably null
PIT4305001:Urgcp UTSW 11 5717996 missense probably damaging 1.00
R0279:Urgcp UTSW 11 5716989 missense probably benign 0.14
R0555:Urgcp UTSW 11 5717477 missense probably damaging 1.00
R1595:Urgcp UTSW 11 5717447 missense probably damaging 1.00
R1808:Urgcp UTSW 11 5717242 missense probably damaging 1.00
R1891:Urgcp UTSW 11 5716910 missense probably benign 0.43
R1993:Urgcp UTSW 11 5716526 missense probably damaging 1.00
R3155:Urgcp UTSW 11 5716327 missense probably damaging 1.00
R3769:Urgcp UTSW 11 5717000 missense probably damaging 1.00
R4209:Urgcp UTSW 11 5715878 missense probably damaging 0.99
R4210:Urgcp UTSW 11 5715878 missense probably damaging 0.99
R4211:Urgcp UTSW 11 5715878 missense probably damaging 0.99
R5335:Urgcp UTSW 11 5717754 missense possibly damaging 0.66
R6242:Urgcp UTSW 11 5716691 missense probably benign 0.34
R6971:Urgcp UTSW 11 5718115 missense probably benign 0.34
R7411:Urgcp UTSW 11 5718116 missense probably benign 0.10
R7460:Urgcp UTSW 11 5716622 missense possibly damaging 0.88
R7734:Urgcp UTSW 11 5716406 missense probably benign 0.00
R7809:Urgcp UTSW 11 5723133 missense probably benign 0.02
X0005:Urgcp UTSW 11 5718231 missense probably damaging 1.00
Z1176:Urgcp UTSW 11 5717103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGGCCTCACTGTAGCCCAAG -3'
(R):5'- TGCCTGGCACAGGGAAATCTACAC -3'

Sequencing Primer
(F):5'- TGTAGCCCAAGCTCACAGC -3'
(R):5'- CTGTGACCAGATCCTGGTAATAGAC -3'
Posted On2014-01-05