Incidental Mutation 'R1110:Pcgf2'
ID96674
Institutional Source Beutler Lab
Gene Symbol Pcgf2
Ensembl Gene ENSMUSG00000018537
Gene Namepolycomb group ring finger 2
Synonymsmel-18, Rnf110, Zfp144
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1110 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location97688823-97700497 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 97691850 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018681] [ENSMUST00000103148] [ENSMUST00000103149] [ENSMUST00000107583] [ENSMUST00000107584] [ENSMUST00000107585] [ENSMUST00000169807] [ENSMUST00000179765]
Predicted Effect probably benign
Transcript: ENSMUST00000018681
SMART Domains Protein: ENSMUSP00000018681
Gene: ENSMUSG00000018537

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103148
SMART Domains Protein: ENSMUSP00000099437
Gene: ENSMUSG00000018537

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103149
SMART Domains Protein: ENSMUSP00000099438
Gene: ENSMUSG00000018537

DomainStartEndE-ValueType
low complexity region 79 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107583
SMART Domains Protein: ENSMUSP00000103209
Gene: ENSMUSG00000078695

DomainStartEndE-ValueType
ZnF_CDGSH 54 88 3.39e-9 SMART
ZnF_CDGSH 92 129 5.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107584
SMART Domains Protein: ENSMUSP00000103210
Gene: ENSMUSG00000078695

DomainStartEndE-ValueType
ZnF_CDGSH 32 66 3.39e-9 SMART
ZnF_CDGSH 70 107 5.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107585
SMART Domains Protein: ENSMUSP00000103211
Gene: ENSMUSG00000078695

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
ZnF_CDGSH 51 85 3.39e-9 SMART
ZnF_CDGSH 89 126 5.55e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134003
Predicted Effect probably benign
Transcript: ENSMUST00000169807
SMART Domains Protein: ENSMUSP00000126967
Gene: ENSMUSG00000018537

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
Pfam:RAWUL 146 228 1.9e-26 PFAM
low complexity region 263 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179765
SMART Domains Protein: ENSMUSP00000137517
Gene: ENSMUSG00000018537

DomainStartEndE-ValueType
RING 18 56 4.99e-5 SMART
low complexity region 263 318 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and is similar to the polycomb group (PcG) gene products. PcG gene products form complexes via protein-protein interaction and maintain the transcription repression of genes involved in embryogenesis, cell cycles, and tumorigenesis. This protein was shown to act as a negative regulator of transcription and has tumor suppressor activity. The expression of this gene was detected in various tumor cells, but is limited in neural organs in normal tissues. Knockout studies in mice suggested that this protein may negatively regulate the expression of different cytokines, chemokines, and chemokine receptors, and thus plays an important role in lymphocyte differentiation and migration, as well as in immune responses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit multiple abnormalities of the axial skeleton (including homeotic transformations), grow markedly slower, and die either perinatally or between 3-6 weeks of age depending on genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Fbxl13 T C 5: 21,484,036 D758G probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pde3a T C 6: 141,459,316 probably benign Het
Pibf1 C T 14: 99,112,973 R186C probably damaging Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Samd9l T A 6: 3,374,267 D998V probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Urgcp T C 11: 5,716,004 N778S probably benign Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Pcgf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Pcgf2 APN 11 97690240 missense probably benign 0.01
IGL01877:Pcgf2 APN 11 97692533 missense probably damaging 1.00
IGL02473:Pcgf2 APN 11 97691921 splice site probably benign
R0243:Pcgf2 UTSW 11 97692418 unclassified probably null
R0522:Pcgf2 UTSW 11 97692047 missense probably benign 0.31
R0712:Pcgf2 UTSW 11 97691004 missense probably damaging 1.00
R0781:Pcgf2 UTSW 11 97691850 splice site probably benign
R4295:Pcgf2 UTSW 11 97693456 nonsense probably null
R4959:Pcgf2 UTSW 11 97691689 missense possibly damaging 0.85
R5569:Pcgf2 UTSW 11 97692367 critical splice donor site probably null
R5622:Pcgf2 UTSW 11 97690252 missense probably damaging 1.00
R5779:Pcgf2 UTSW 11 97690291 missense probably damaging 1.00
R6001:Pcgf2 UTSW 11 97692780 missense possibly damaging 0.91
R6090:Pcgf2 UTSW 11 97690991 missense possibly damaging 0.71
R6360:Pcgf2 UTSW 11 97692409 unclassified probably null
Z1176:Pcgf2 UTSW 11 97690021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTCAAAGAAGCAAAGTCAAGCG -3'
(R):5'- GCAAGTTCAACGTAGGCCCCTTTTC -3'

Sequencing Primer
(F):5'- AGAGTTCCTTGGCCCTATCAAAG -3'
(R):5'- CTACCCTGGCCCATTCTTCAAG -3'
Posted On2014-01-05