Incidental Mutation 'R1018:Ppp1r32'
ID96685
Institutional Source Beutler Lab
Gene Symbol Ppp1r32
Ensembl Gene ENSMUSG00000035179
Gene Nameprotein phosphatase 1, regulatory subunit 32
SynonymsIIIG9L, 4930579J09Rik, IIIG9S, IIIG9
MMRRC Submission 039122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1018 (G1)
Quality Score180
Status Validated
Chromosome19
Chromosomal Location10474257-10482897 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 10479460 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035684 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000038842
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 80,001,491 C403F probably damaging Het
Adam20 C T 8: 40,796,109 Q419* probably null Het
Ankrd36 C T 11: 5,646,876 probably benign Het
Arl8b T A 6: 108,818,611 I170K probably damaging Het
Atp5f1 A T 3: 105,954,172 V78E possibly damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cgnl1 A G 9: 71,726,058 Y4H probably damaging Het
Cnn2 T C 10: 79,993,563 C176R probably damaging Het
Dst A G 1: 34,194,093 D3392G probably damaging Het
Eed T C 7: 89,967,811 probably benign Het
Efl1 T A 7: 82,763,013 V870E possibly damaging Het
Epx T C 11: 87,869,303 N495S probably benign Het
Fbxw20 T A 9: 109,221,336 Y407F probably benign Het
Gbp9 T A 5: 105,080,260 Q552L probably benign Het
Hspa13 C A 16: 75,761,276 V134L possibly damaging Het
Il16 T C 7: 83,674,538 N268S probably damaging Het
Kif14 G A 1: 136,495,841 probably benign Het
Lrig1 G A 6: 94,622,602 probably benign Het
Myo7a T A 7: 98,107,005 D29V probably damaging Het
Nsd2 A G 5: 33,843,241 K34R probably damaging Het
Olfr1234 C A 2: 89,363,179 L83F possibly damaging Het
P3h1 C A 4: 119,237,907 T287K probably damaging Het
Pkhd1 A T 1: 20,201,259 H3023Q possibly damaging Het
Plxna1 A G 6: 89,342,960 L535P probably damaging Het
Prom1 A T 5: 44,029,714 S400R probably benign Het
Psap T G 10: 60,300,811 L523R probably damaging Het
Psme4 C T 11: 30,804,310 T189I probably damaging Het
Ptpn12 A T 5: 21,029,869 S39T possibly damaging Het
Qtrt2 T A 16: 43,878,000 H98L possibly damaging Het
Rad54l2 C A 9: 106,712,390 C601F probably benign Het
Sfswap A G 5: 129,554,576 K756R possibly damaging Het
Slc24a5 T C 2: 125,068,907 V86A probably damaging Het
Srrm2 T C 17: 23,822,540 S2575P probably damaging Het
Stam T C 2: 14,117,374 probably benign Het
Tbx6 T A 7: 126,783,192 probably benign Het
Tmem131 A C 1: 36,794,819 F1727V probably damaging Het
Tpr T A 1: 150,442,183 H2147Q possibly damaging Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Uba5 T C 9: 104,049,903 T292A probably benign Het
Unc5a T A 13: 54,990,952 V48E possibly damaging Het
Upf1 G T 8: 70,338,906 H514Q possibly damaging Het
Usp9y A G Y: 1,341,414 probably benign Het
Vmn2r6 T A 3: 64,556,840 D191V probably benign Het
Wapl T C 14: 34,691,906 Y242H possibly damaging Het
Zfp341 A T 2: 154,646,052 N812Y probably damaging Het
Zfp358 C A 8: 3,496,843 S475* probably null Het
Zfp957 C A 14: 79,212,742 C539F probably damaging Het
Other mutations in Ppp1r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ppp1r32 APN 19 10477523 critical splice donor site probably null
IGL00979:Ppp1r32 APN 19 10474499 makesense probably null
IGL02405:Ppp1r32 APN 19 10474566 missense probably damaging 1.00
IGL02664:Ppp1r32 APN 19 10482291 missense probably damaging 1.00
IGL03105:Ppp1r32 APN 19 10477020 splice site probably benign
R0255:Ppp1r32 UTSW 19 10475054 missense probably damaging 1.00
R0268:Ppp1r32 UTSW 19 10477085 missense possibly damaging 0.88
R1559:Ppp1r32 UTSW 19 10481406 missense probably benign 0.01
R2384:Ppp1r32 UTSW 19 10481282 critical splice donor site probably null
R4362:Ppp1r32 UTSW 19 10475021 missense probably damaging 1.00
R4884:Ppp1r32 UTSW 19 10474501 makesense probably null
R5998:Ppp1r32 UTSW 19 10481352 missense possibly damaging 0.50
R6130:Ppp1r32 UTSW 19 10477764 missense probably benign 0.16
R6360:Ppp1r32 UTSW 19 10479481 missense probably damaging 1.00
R6388:Ppp1r32 UTSW 19 10482301 missense probably damaging 1.00
R6625:Ppp1r32 UTSW 19 10481736 missense probably damaging 0.97
R6754:Ppp1r32 UTSW 19 10477089 missense probably damaging 1.00
R7188:Ppp1r32 UTSW 19 10482338 missense probably benign 0.15
R7361:Ppp1r32 UTSW 19 10479579 missense probably damaging 1.00
R7679:Ppp1r32 UTSW 19 10482254 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGGTATGGTGGACACTTTGATG -3'
(R):5'- GACAGAATGTGACTGGCACTCTCTC -3'

Sequencing Primer
(F):5'- agaagtgggagtgggtagg -3'
(R):5'- GACTGGCACTCTCTCTCACG -3'
Posted On2014-01-05