Mutagenetix > Incidental Mutations

Incidental Mutation 'R1110:Olfr743'

96688

Institutional Source

Beutler Lab

Gene Symbol

Olfr743

Ensembl Gene

ENSMUSG00000094285

Gene Name

olfactory receptor 743

Synonyms

Olfr264, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, MOR106-14, Olfr265, Olfr743-ps1

MMRRC Submission

039183-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R1110 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50521839-50534955 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50533702 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 97 (S97P)

Ref Sequence

ENSEMBL: ENSMUSP00000150946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071294] [ENSMUST00000215793]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071294
AA Change: S97P

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000071263
Gene: ENSMUSG00000094285
AA Change: S97P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	35	311	1.6e-56	PFAM
Pfam:7tm_1	45	294	1e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215793
AA Change: S97P

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

Meta Mutation Damage Score

0.1199

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 94.3%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap3	T	A	4: 155,905,399		probably null	Het
Acp2	A	G	2: 91,208,422		probably null	Het
Akap13	T	G	7: 75,611,377	S447A	possibly damaging	Het
Alk	G	A	17: 71,984,745		probably benign	Het
Arhgef39	T	C	4: 43,496,834	T327A	probably benign	Het
Cdan1	G	A	2: 120,720,602	A1103V	probably damaging	Het
Cdh18	A	G	15: 23,474,317	T758A	probably benign	Het
Cdk17	T	A	10: 93,239,033	Y3*	probably null	Het
Cdon	T	C	9: 35,456,437		probably benign	Het
Cntn3	T	A	6: 102,245,158	N460I	probably benign	Het
Cntrl	T	A	2: 35,160,627	C985S	possibly damaging	Het
Col6a2	T	C	10: 76,607,740	E497G	probably benign	Het
Crybg1	A	G	10: 43,999,093	M673T	possibly damaging	Het
Cyp2u1	A	G	3: 131,293,609	I441T	possibly damaging	Het
Disp2	T	C	2: 118,790,439	S551P	probably damaging	Het
Dock2	A	T	11: 34,256,535	F1354I	possibly damaging	Het
Dstyk	A	G	1: 132,453,325		probably benign	Het
Dzip1	T	C	14: 118,889,305	N527S	probably benign	Het
Eomes	A	G	9: 118,484,599	I571V	probably benign	Het
Fam26e	T	G	10: 34,096,017	I141L	probably benign	Het
Fbxl13	T	C	5: 21,484,036	D758G	probably benign	Het
Frem1	T	C	4: 82,950,320	S1457G	probably damaging	Het
Gabbr2	C	T	4: 46,718,838	C613Y	probably damaging	Het
Gm906	A	T	13: 50,248,260	D83E	possibly damaging	Het
Gm9755	A	T	8: 67,515,058		noncoding transcript	Het
Hnrnpul2	A	G	19: 8,826,746	R570G	probably damaging	Het
Igdcc4	A	G	9: 65,126,926	H674R	possibly damaging	Het
Kdm5d	T	A	Y: 910,539	L250H	probably damaging	Het
Kif1a	T	C	1: 93,023,453		probably benign	Het
Kmt2c	T	C	5: 25,314,362	N2250S	probably benign	Het
Kmt2e	C	T	5: 23,502,655	H1739Y	probably damaging	Het
Lmtk3	T	A	7: 45,795,003		probably benign	Het
Lpin3	A	G	2: 160,894,079	D93G	probably benign	Het
Myh10	T	C	11: 68,791,850		probably benign	Het
Myom2	G	A	8: 15,122,413	E1171K	probably benign	Het
Ncoa6	A	T	2: 155,411,520		probably benign	Het
Nup160	A	G	2: 90,733,219		probably benign	Het
Oit3	G	A	10: 59,428,194	R373C	probably damaging	Het
Olfml2a	A	T	2: 38,959,753	I494L	probably damaging	Het
Olfr824	A	G	10: 130,126,653	Y135H	probably damaging	Het
Parp6	G	T	9: 59,649,564	C584F	probably damaging	Het
Pcgf2	A	G	11: 97,691,850		probably benign	Het
Pde3a	T	C	6: 141,459,316		probably benign	Het
Pibf1	C	T	14: 99,112,973	R186C	probably damaging	Het
Pitrm1	A	G	13: 6,558,244	D335G	probably benign	Het
Pkp4	T	C	2: 59,338,765	L752P	probably damaging	Het
Plcb3	C	A	19: 6,961,913	E566*	probably null	Het
Prune2	T	C	19: 17,125,222	S2582P	probably benign	Het
Reln	A	T	5: 22,034,775	D831E	probably benign	Het
Samd9l	T	A	6: 3,374,267	D998V	probably benign	Het
Sardh	G	A	2: 27,191,919	T865I	possibly damaging	Het
Setbp1	G	A	18: 78,857,860	T864I	probably damaging	Het
Slc9a1	T	A	4: 133,370,548	M2K	probably benign	Het
Sorbs2	A	G	8: 45,795,730	T593A	probably benign	Het
Svs5	A	T	2: 164,333,587	I120L	probably benign	Het
Tcl1b1	G	T	12: 105,159,815	V19F	probably damaging	Het
Ttc30a1	A	T	2: 75,979,976	C588S	probably damaging	Het
Urgcp	T	C	11: 5,716,004	N778S	probably benign	Het
Vnn1	A	T	10: 23,899,601	I250F	possibly damaging	Het
Xntrpc	A	G	7: 102,082,974	R365G	possibly damaging	Het
Zfp84	T	A	7: 29,771,372	M1K	probably null	Het
Zfyve26	G	A	12: 79,280,067	R761C	probably damaging	Het
Zp3r	A	G	1: 130,577,884		probably null	Het

Other mutations in Olfr743

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01128:Olfr743	APN	14	50533949	missense	probably damaging	1.00
IGL01551:Olfr743	APN	14	50534161	missense	probably benign
IGL02024:Olfr743	APN	14	50533850	missense	probably benign	0.00
IGL02867:Olfr743	APN	14	50533513	missense	probably benign
IGL02889:Olfr743	APN	14	50533513	missense	probably benign
IGL03195:Olfr743	APN	14	50533420	missense	probably benign
IGL03296:Olfr743	APN	14	50533945	missense	possibly damaging	0.90
R0049:Olfr743	UTSW	14	50533694	missense	probably damaging	1.00
R0049:Olfr743	UTSW	14	50533694	missense	probably damaging	1.00
R0102:Olfr743	UTSW	14	50533631	missense	probably damaging	1.00
R0556:Olfr743	UTSW	14	50533924	missense	probably benign	0.01
R0626:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R0661:Olfr743	UTSW	14	50534095	missense	probably benign
R0759:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R0761:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R0894:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1109:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1312:Olfr743	UTSW	14	50534195	missense	probably benign
R1446:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1470:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1470:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1502:Olfr743	UTSW	14	50533777	missense	possibly damaging	0.47
R1518:Olfr743	UTSW	14	50534165	missense	probably damaging	1.00
R1529:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1624:Olfr743	UTSW	14	50533643	missense	probably damaging	1.00
R1646:Olfr743	UTSW	14	50533583	missense	probably benign	0.01
R1687:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1795:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R2011:Olfr743	UTSW	14	50533684	missense	probably damaging	1.00
R2120:Olfr743	UTSW	14	50533946	missense	probably damaging	1.00
R2697:Olfr743	UTSW	14	50533781	missense	probably damaging	1.00
R2857:Olfr743	UTSW	14	50533440	missense	probably benign	0.19
R2858:Olfr743	UTSW	14	50533440	missense	probably benign	0.19
R3906:Olfr743	UTSW	14	50533754	missense	probably benign	0.03
R4327:Olfr743	UTSW	14	50533514	missense	probably benign	0.05
R4355:Olfr743	UTSW	14	50533759	missense	possibly damaging	0.94
R4663:Olfr743	UTSW	14	50533604	missense	probably damaging	1.00
R5214:Olfr743	UTSW	14	50534347	makesense	probably null
R5964:Olfr743	UTSW	14	50534198	missense	probably damaging	0.99
R6148:Olfr743	UTSW	14	50534321	missense	probably benign	0.00
R6167:Olfr743	UTSW	14	50534155	missense	probably damaging	1.00
R6301:Olfr743	UTSW	14	50534254	missense	probably benign	0.02
R6616:Olfr743	UTSW	14	50533907	missense	probably benign	0.43
R6910:Olfr743	UTSW	14	50533873	missense	probably benign	0.31
R7076:Olfr743	UTSW	14	50533821	nonsense	probably null
R7483:Olfr743	UTSW	14	50534015	missense	probably benign	0.06
R7574:Olfr743	UTSW	14	50534313	missense	probably benign	0.01
R7731:Olfr743	UTSW	14	50533684	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGTGCTTTCACAGAACACAGACAG -3'
(R):5'- ACTGATCACAAGGATGTTGCAGAGG -3'

Sequencing Primer
(F):5'- ACAGGCTTCATCCTTTTGGG -3'
(R):5'- GCGCCTAGTCATGAGAGAAG -3'

Posted On

2014-01-05