Incidental Mutation 'R1018:Usp9y'
ID 96689
Institutional Source Beutler Lab
Gene Symbol Usp9y
Ensembl Gene ENSMUSG00000069044
Gene Name ubiquitin specific peptidase 9, Y chromosome
Synonyms Fafl2, Dffry
MMRRC Submission 039122-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R1018 (G1)
Quality Score 222
Status Validated
Chromosome Y
Chromosomal Location 1298961-1459782 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 1341414 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091188]
AlphaFold F8VPU6
Predicted Effect probably benign
Transcript: ENSMUST00000091188
SMART Domains Protein: ENSMUSP00000088727
Gene: ENSMUSG00000069044

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
low complexity region 286 301 N/A INTRINSIC
low complexity region 973 983 N/A INTRINSIC
low complexity region 1089 1100 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
Pfam:UCH 1558 1955 9.2e-53 PFAM
Pfam:UCH_1 1559 1909 4e-22 PFAM
low complexity region 1959 1971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase C19 family. It encodes a protein that is similar to ubiquitin-specific proteases, which cleave the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,837,325 (GRCm39) C403F probably damaging Het
Adam20 C T 8: 41,249,146 (GRCm39) Q419* probably null Het
Ankrd36 C T 11: 5,596,876 (GRCm39) probably benign Het
Arl8b T A 6: 108,795,572 (GRCm39) I170K probably damaging Het
Atp5pb A T 3: 105,861,488 (GRCm39) V78E possibly damaging Het
Car9 G T 4: 43,512,439 (GRCm39) probably null Het
Cgnl1 A G 9: 71,633,340 (GRCm39) Y4H probably damaging Het
Cnn2 T C 10: 79,829,397 (GRCm39) C176R probably damaging Het
Dst A G 1: 34,233,174 (GRCm39) D3392G probably damaging Het
Eed T C 7: 89,617,019 (GRCm39) probably benign Het
Efl1 T A 7: 82,412,221 (GRCm39) V870E possibly damaging Het
Epx T C 11: 87,760,129 (GRCm39) N495S probably benign Het
Fbxw20 T A 9: 109,050,404 (GRCm39) Y407F probably benign Het
Gbp9 T A 5: 105,228,126 (GRCm39) Q552L probably benign Het
Hspa13 C A 16: 75,558,164 (GRCm39) V134L possibly damaging Het
Il16 T C 7: 83,323,746 (GRCm39) N268S probably damaging Het
Kif14 G A 1: 136,423,579 (GRCm39) probably benign Het
Lrig1 G A 6: 94,599,583 (GRCm39) probably benign Het
Myo7a T A 7: 97,756,212 (GRCm39) D29V probably damaging Het
Nsd2 A G 5: 34,000,585 (GRCm39) K34R probably damaging Het
Or4a15 C A 2: 89,193,523 (GRCm39) L83F possibly damaging Het
P3h1 C A 4: 119,095,104 (GRCm39) T287K probably damaging Het
Pkhd1 A T 1: 20,271,483 (GRCm39) H3023Q possibly damaging Het
Plxna1 A G 6: 89,319,942 (GRCm39) L535P probably damaging Het
Prom1 A T 5: 44,187,056 (GRCm39) S400R probably benign Het
Psap T G 10: 60,136,590 (GRCm39) L523R probably damaging Het
Psme4 C T 11: 30,754,310 (GRCm39) T189I probably damaging Het
Ptpn12 A T 5: 21,234,867 (GRCm39) S39T possibly damaging Het
Qtrt2 T A 16: 43,698,363 (GRCm39) H98L possibly damaging Het
Rad54l2 C A 9: 106,589,589 (GRCm39) C601F probably benign Het
Saxo4 A T 19: 10,456,824 (GRCm39) probably benign Het
Sfswap A G 5: 129,631,640 (GRCm39) K756R possibly damaging Het
Slc24a5 T C 2: 124,910,827 (GRCm39) V86A probably damaging Het
Srrm2 T C 17: 24,041,514 (GRCm39) S2575P probably damaging Het
Stam T C 2: 14,122,185 (GRCm39) probably benign Het
Tbx6 T A 7: 126,382,364 (GRCm39) probably benign Het
Tmem131 A C 1: 36,833,900 (GRCm39) F1727V probably damaging Het
Tpr T A 1: 150,317,934 (GRCm39) H2147Q possibly damaging Het
Trio T A 15: 27,871,257 (GRCm39) H620L probably damaging Het
Uba5 T C 9: 103,927,102 (GRCm39) T292A probably benign Het
Unc5a T A 13: 55,138,765 (GRCm39) V48E possibly damaging Het
Upf1 G T 8: 70,791,556 (GRCm39) H514Q possibly damaging Het
Vmn2r6 T A 3: 64,464,261 (GRCm39) D191V probably benign Het
Wapl T C 14: 34,413,863 (GRCm39) Y242H possibly damaging Het
Zfp341 A T 2: 154,487,972 (GRCm39) N812Y probably damaging Het
Zfp358 C A 8: 3,546,843 (GRCm39) S475* probably null Het
Zfp957 C A 14: 79,450,182 (GRCm39) C539F probably damaging Het
Other mutations in Usp9y
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4466001:Usp9y UTSW Y 1,432,197 (GRCm39) missense probably damaging 0.96
R0288:Usp9y UTSW Y 1,333,606 (GRCm39) splice site probably benign
R0365:Usp9y UTSW Y 1,364,732 (GRCm39) missense probably damaging 1.00
R0386:Usp9y UTSW Y 1,316,933 (GRCm39) missense probably damaging 1.00
R0395:Usp9y UTSW Y 1,340,053 (GRCm39) missense probably damaging 1.00
R0518:Usp9y UTSW Y 1,307,880 (GRCm39) missense probably benign
R0521:Usp9y UTSW Y 1,307,880 (GRCm39) missense probably benign
R0530:Usp9y UTSW Y 1,333,600 (GRCm39) splice site probably benign
R0759:Usp9y UTSW Y 1,299,097 (GRCm39) missense probably damaging 0.99
R0849:Usp9y UTSW Y 1,394,002 (GRCm39) missense probably damaging 1.00
R0932:Usp9y UTSW Y 1,315,930 (GRCm39) missense probably benign 0.37
R1208:Usp9y UTSW Y 1,356,282 (GRCm39) missense probably benign
R1208:Usp9y UTSW Y 1,356,282 (GRCm39) missense probably benign
R1470:Usp9y UTSW Y 1,332,471 (GRCm39) missense probably benign 0.19
R1470:Usp9y UTSW Y 1,332,471 (GRCm39) missense probably benign 0.19
R1730:Usp9y UTSW Y 1,367,093 (GRCm39) missense probably benign 0.18
R1743:Usp9y UTSW Y 1,316,727 (GRCm39) missense probably damaging 1.00
R1765:Usp9y UTSW Y 1,384,454 (GRCm39) missense possibly damaging 0.88
R1775:Usp9y UTSW Y 1,368,089 (GRCm39) missense probably damaging 1.00
R1783:Usp9y UTSW Y 1,367,093 (GRCm39) missense probably benign 0.18
R1889:Usp9y UTSW Y 1,448,829 (GRCm39) splice site probably null
R1901:Usp9y UTSW Y 1,303,371 (GRCm39) critical splice donor site probably null
R2081:Usp9y UTSW Y 1,381,277 (GRCm39) missense possibly damaging 0.65
R2119:Usp9y UTSW Y 1,303,451 (GRCm39) missense probably benign 0.00
R2357:Usp9y UTSW Y 1,394,050 (GRCm39) missense possibly damaging 0.87
R2873:Usp9y UTSW Y 1,310,502 (GRCm39) splice site probably benign
R3938:Usp9y UTSW Y 1,313,741 (GRCm39) missense probably damaging 0.97
R4323:Usp9y UTSW Y 1,434,407 (GRCm39) missense possibly damaging 0.93
R4385:Usp9y UTSW Y 1,304,756 (GRCm39) missense probably damaging 1.00
R4407:Usp9y UTSW Y 1,336,375 (GRCm39) missense probably benign 0.16
R4457:Usp9y UTSW Y 1,394,078 (GRCm39) missense possibly damaging 0.62
R4747:Usp9y UTSW Y 1,391,284 (GRCm39) missense possibly damaging 0.64
R4823:Usp9y UTSW Y 1,444,559 (GRCm39) missense probably damaging 0.99
R4834:Usp9y UTSW Y 1,317,002 (GRCm39) missense probably benign 0.32
R4872:Usp9y UTSW Y 1,307,920 (GRCm39) missense probably damaging 1.00
R4911:Usp9y UTSW Y 1,308,041 (GRCm39) missense probably damaging 0.96
R4915:Usp9y UTSW Y 1,316,735 (GRCm39) missense probably damaging 0.99
R4962:Usp9y UTSW Y 1,384,336 (GRCm39) missense probably damaging 1.00
R5378:Usp9y UTSW Y 1,315,928 (GRCm39) missense probably damaging 0.99
R5422:Usp9y UTSW Y 1,314,676 (GRCm39) missense probably benign
R5432:Usp9y UTSW Y 1,368,022 (GRCm39) splice site probably null
R5442:Usp9y UTSW Y 1,336,467 (GRCm39) missense possibly damaging 0.80
R5469:Usp9y UTSW Y 1,364,714 (GRCm39) missense probably benign 0.01
R5500:Usp9y UTSW Y 1,341,875 (GRCm39) missense probably damaging 1.00
R5729:Usp9y UTSW Y 1,381,339 (GRCm39) missense probably damaging 0.97
R5891:Usp9y UTSW Y 1,341,535 (GRCm39) missense probably benign 0.05
R5920:Usp9y UTSW Y 1,316,730 (GRCm39) missense probably damaging 1.00
R5948:Usp9y UTSW Y 1,324,996 (GRCm39) missense possibly damaging 0.79
R6062:Usp9y UTSW Y 1,454,199 (GRCm39) missense probably benign 0.28
R6265:Usp9y UTSW Y 1,446,843 (GRCm39) missense probably benign 0.00
R6274:Usp9y UTSW Y 1,316,735 (GRCm39) missense probably damaging 0.99
R6313:Usp9y UTSW Y 1,385,355 (GRCm39) missense probably benign
R6330:Usp9y UTSW Y 1,340,123 (GRCm39) missense probably benign 0.20
R6471:Usp9y UTSW Y 1,384,511 (GRCm39) missense probably damaging 1.00
R6547:Usp9y UTSW Y 1,444,612 (GRCm39) missense probably damaging 0.99
R6791:Usp9y UTSW Y 1,325,042 (GRCm39) splice site probably null
R7194:Usp9y UTSW Y 1,304,672 (GRCm39) missense probably damaging 1.00
R7341:Usp9y UTSW Y 1,315,759 (GRCm39) splice site probably null
R7357:Usp9y UTSW Y 1,333,656 (GRCm39) missense possibly damaging 0.58
R7374:Usp9y UTSW Y 1,381,305 (GRCm39) missense probably benign 0.00
R7404:Usp9y UTSW Y 1,341,780 (GRCm39) missense probably benign 0.35
R7481:Usp9y UTSW Y 1,432,180 (GRCm39) missense probably benign 0.08
R7584:Usp9y UTSW Y 1,384,451 (GRCm39) missense probably damaging 1.00
R7697:Usp9y UTSW Y 1,316,990 (GRCm39) missense possibly damaging 0.72
R7713:Usp9y UTSW Y 1,304,411 (GRCm39) nonsense probably null
R7790:Usp9y UTSW Y 1,444,573 (GRCm39) missense probably damaging 1.00
R7900:Usp9y UTSW Y 1,384,354 (GRCm39) missense possibly damaging 0.49
R7964:Usp9y UTSW Y 1,316,914 (GRCm39) missense probably benign 0.19
R8396:Usp9y UTSW Y 1,308,034 (GRCm39) missense possibly damaging 0.81
R8703:Usp9y UTSW Y 1,356,317 (GRCm39) missense probably damaging 0.98
R8776:Usp9y UTSW Y 1,356,320 (GRCm39) missense probably benign 0.15
R8776-TAIL:Usp9y UTSW Y 1,356,320 (GRCm39) missense probably benign 0.15
R8855:Usp9y UTSW Y 1,395,758 (GRCm39) missense probably damaging 1.00
R8866:Usp9y UTSW Y 1,395,758 (GRCm39) missense probably damaging 1.00
R8952:Usp9y UTSW Y 1,332,662 (GRCm39) intron probably benign
R9008:Usp9y UTSW Y 1,434,993 (GRCm39) missense possibly damaging 0.69
R9011:Usp9y UTSW Y 1,316,978 (GRCm39) missense probably benign 0.00
R9076:Usp9y UTSW Y 1,383,354 (GRCm39) missense probably benign 0.08
R9256:Usp9y UTSW Y 1,356,235 (GRCm39) missense possibly damaging 0.87
R9332:Usp9y UTSW Y 1,341,873 (GRCm39) missense probably damaging 1.00
R9367:Usp9y UTSW Y 1,324,982 (GRCm39) missense probably damaging 1.00
R9382:Usp9y UTSW Y 1,364,776 (GRCm39) missense probably benign 0.08
R9503:Usp9y UTSW Y 1,316,045 (GRCm39) missense possibly damaging 0.89
R9515:Usp9y UTSW Y 1,432,188 (GRCm39) missense probably benign 0.28
R9792:Usp9y UTSW Y 1,364,679 (GRCm39) missense probably benign 0.16
R9793:Usp9y UTSW Y 1,364,679 (GRCm39) missense probably benign 0.16
R9795:Usp9y UTSW Y 1,364,679 (GRCm39) missense probably benign 0.16
RF005:Usp9y UTSW Y 1,435,046 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ACAGGCTGCTTGTGTGACATAATTAACA -3'
(R):5'- CTTTGCTACCAGTTAAGTGCCAGTGTA -3'

Sequencing Primer
(F):5'- CCAAAACTGAACTGTTCCTCTTGC -3'
(R):5'- GCATGGGACATAGACCTTTGC -3'
Posted On 2014-01-05