Incidental Mutation 'R1110:Pibf1'
ID96691
Institutional Source Beutler Lab
Gene Symbol Pibf1
Ensembl Gene ENSMUSG00000022064
Gene Nameprogesterone immunomodulatory binding factor 1
Synonyms1700017E21Rik, 4933438D16Rik, 4933439E17Rik, D14Ertd581e, 4930513H15Rik
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1110 (G1)
Quality Score219
Status Validated
Chromosome14
Chromosomal Location99099424-99254493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99112973 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 186 (R186C)
Ref Sequence ENSEMBL: ENSMUSP00000022650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022650]
Predicted Effect probably damaging
Transcript: ENSMUST00000022650
AA Change: R186C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022650
Gene: ENSMUSG00000022064
AA Change: R186C

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
coiled coil region 58 165 N/A INTRINSIC
coiled coil region 200 364 N/A INTRINSIC
coiled coil region 396 444 N/A INTRINSIC
coiled coil region 474 553 N/A INTRINSIC
coiled coil region 586 679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228598
Meta Mutation Damage Score 0.3356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Fbxl13 T C 5: 21,484,036 D758G probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Samd9l T A 6: 3,374,267 D998V probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Urgcp T C 11: 5,716,004 N778S probably benign Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Pibf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Pibf1 APN 14 99179449 nonsense probably null
IGL01649:Pibf1 APN 14 99187763 missense possibly damaging 0.88
IGL01817:Pibf1 APN 14 99186472 splice site probably benign
IGL02322:Pibf1 APN 14 99210983 missense probably damaging 1.00
IGL03180:Pibf1 APN 14 99133344 missense probably benign 0.14
IGL03269:Pibf1 APN 14 99187735 missense probably damaging 0.98
IGL03354:Pibf1 APN 14 99150738 missense probably benign 0.13
R0053:Pibf1 UTSW 14 99140557 missense probably damaging 1.00
R0969:Pibf1 UTSW 14 99196386 missense probably benign 0.02
R0981:Pibf1 UTSW 14 99150743 critical splice donor site probably null
R1205:Pibf1 UTSW 14 99101203 missense probably damaging 1.00
R1356:Pibf1 UTSW 14 99137196 missense possibly damaging 0.91
R1432:Pibf1 UTSW 14 99112989 missense probably benign 0.14
R1622:Pibf1 UTSW 14 99186481 missense probably benign 0.34
R1912:Pibf1 UTSW 14 99187809 critical splice donor site probably null
R2393:Pibf1 UTSW 14 99242932 missense probably benign 0.07
R3847:Pibf1 UTSW 14 99137121 missense possibly damaging 0.57
R4028:Pibf1 UTSW 14 99179341 missense probably damaging 0.99
R4673:Pibf1 UTSW 14 99133351 missense possibly damaging 0.93
R4857:Pibf1 UTSW 14 99186501 nonsense probably null
R4874:Pibf1 UTSW 14 99140556 missense probably damaging 1.00
R4992:Pibf1 UTSW 14 99150667 missense probably damaging 0.98
R5330:Pibf1 UTSW 14 99140646 missense probably damaging 1.00
R5543:Pibf1 UTSW 14 99112992 missense probably benign 0.38
R5582:Pibf1 UTSW 14 99137130 missense possibly damaging 0.64
R5922:Pibf1 UTSW 14 99137088 missense probably benign
R6088:Pibf1 UTSW 14 99179358 missense probably benign 0.01
R6169:Pibf1 UTSW 14 99113007 missense probably null 0.96
R6226:Pibf1 UTSW 14 99101119 missense probably damaging 1.00
R6232:Pibf1 UTSW 14 99186578 missense probably benign 0.16
R6339:Pibf1 UTSW 14 99107398 missense probably damaging 0.97
R6450:Pibf1 UTSW 14 99137210 missense probably damaging 1.00
R6828:Pibf1 UTSW 14 99186551 missense probably benign 0.31
R7185:Pibf1 UTSW 14 99107316 missense possibly damaging 0.80
R7201:Pibf1 UTSW 14 99196408 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGGATGTTGCCAAGATCCTGTAGT -3'
(R):5'- CCCTGCACAGACGTTAAGAAGCTG -3'

Sequencing Primer
(F):5'- ggaagatgagtggggatgaag -3'
(R):5'- TGCTATGGAAAAGCTGCAATGTC -3'
Posted On2014-01-05