Incidental Mutation 'R1110:Cdh18'
ID 96697
Institutional Source Beutler Lab
Gene Symbol Cdh18
Ensembl Gene ENSMUSG00000040420
Gene Name cadherin 18
Synonyms B230220E17Rik
MMRRC Submission 039183-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R1110 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 22549108-23474504 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23474403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 758 (T758A)
Ref Sequence ENSEMBL: ENSMUSP00000130851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164787] [ENSMUST00000165614] [ENSMUST00000167623] [ENSMUST00000226693]
AlphaFold E9Q9Q6
Predicted Effect probably benign
Transcript: ENSMUST00000164787
AA Change: T758A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130851
Gene: ENSMUSG00000040420
AA Change: T758A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
CA 509 596 3.7e-5 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 6.8e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165614
SMART Domains Protein: ENSMUSP00000128643
Gene: ENSMUSG00000040420

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167623
SMART Domains Protein: ENSMUSP00000128011
Gene: ENSMUSG00000040420

DomainStartEndE-ValueType
CA 22 103 4.24e-14 SMART
CA 127 212 1.37e-31 SMART
CA 236 328 2.76e-13 SMART
CA 351 414 4.15e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226693
Meta Mutation Damage Score 0.1429 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,989,856 (GRCm39) probably null Het
Acp2 A G 2: 91,038,767 (GRCm39) probably null Het
Akap13 T G 7: 75,261,125 (GRCm39) S447A possibly damaging Het
Alk G A 17: 72,291,740 (GRCm39) probably benign Het
Arhgef39 T C 4: 43,496,834 (GRCm39) T327A probably benign Het
Calhm5 T G 10: 33,972,013 (GRCm39) I141L probably benign Het
Cdan1 G A 2: 120,551,083 (GRCm39) A1103V probably damaging Het
Cdk17 T A 10: 93,074,895 (GRCm39) Y3* probably null Het
Cdon T C 9: 35,367,733 (GRCm39) probably benign Het
Cntn3 T A 6: 102,222,119 (GRCm39) N460I probably benign Het
Cntrl T A 2: 35,050,639 (GRCm39) C985S possibly damaging Het
Col6a2 T C 10: 76,443,574 (GRCm39) E497G probably benign Het
Crybg1 A G 10: 43,875,089 (GRCm39) M673T possibly damaging Het
Cyp2u1 A G 3: 131,087,258 (GRCm39) I441T possibly damaging Het
Disp2 T C 2: 118,620,920 (GRCm39) S551P probably damaging Het
Dock2 A T 11: 34,206,535 (GRCm39) F1354I possibly damaging Het
Dstyk A G 1: 132,381,063 (GRCm39) probably benign Het
Dzip1 T C 14: 119,126,717 (GRCm39) N527S probably benign Het
Eomes A G 9: 118,313,667 (GRCm39) I571V probably benign Het
Fbxl13 T C 5: 21,689,034 (GRCm39) D758G probably benign Het
Frem1 T C 4: 82,868,557 (GRCm39) S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 (GRCm39) C613Y probably damaging Het
Gm9755 A T 8: 67,967,710 (GRCm39) noncoding transcript Het
Hnrnpul2 A G 19: 8,804,110 (GRCm39) R570G probably damaging Het
Ift70a1 A T 2: 75,810,320 (GRCm39) C588S probably damaging Het
Igdcc4 A G 9: 65,034,208 (GRCm39) H674R possibly damaging Het
Kdm5d T A Y: 910,539 (GRCm39) L250H probably damaging Het
Kif1a T C 1: 92,951,175 (GRCm39) probably benign Het
Kmt2c T C 5: 25,519,360 (GRCm39) N2250S probably benign Het
Kmt2e C T 5: 23,707,653 (GRCm39) H1739Y probably damaging Het
Lmtk3 T A 7: 45,444,427 (GRCm39) probably benign Het
Lpin3 A G 2: 160,735,999 (GRCm39) D93G probably benign Het
Myh10 T C 11: 68,682,676 (GRCm39) probably benign Het
Myom2 G A 8: 15,172,413 (GRCm39) E1171K probably benign Het
Ncoa6 A T 2: 155,253,440 (GRCm39) probably benign Het
Nup160 A G 2: 90,563,563 (GRCm39) probably benign Het
Oit3 G A 10: 59,264,016 (GRCm39) R373C probably damaging Het
Olfml2a A T 2: 38,849,765 (GRCm39) I494L probably damaging Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
Or9r7 A G 10: 129,962,522 (GRCm39) Y135H probably damaging Het
Parp6 G T 9: 59,556,847 (GRCm39) C584F probably damaging Het
Pcgf2 A G 11: 97,582,676 (GRCm39) probably benign Het
Pde3a T C 6: 141,405,042 (GRCm39) probably benign Het
Pibf1 C T 14: 99,350,409 (GRCm39) R186C probably damaging Het
Pitrm1 A G 13: 6,608,280 (GRCm39) D335G probably benign Het
Pkp4 T C 2: 59,169,109 (GRCm39) L752P probably damaging Het
Plcb3 C A 19: 6,939,281 (GRCm39) E566* probably null Het
Prune2 T C 19: 17,102,586 (GRCm39) S2582P probably benign Het
Reln A T 5: 22,239,773 (GRCm39) D831E probably benign Het
Samd9l T A 6: 3,374,267 (GRCm39) D998V probably benign Het
Sardh G A 2: 27,081,931 (GRCm39) T865I possibly damaging Het
Setbp1 G A 18: 78,901,075 (GRCm39) T864I probably damaging Het
Slc9a1 T A 4: 133,097,859 (GRCm39) M2K probably benign Het
Sorbs2 A G 8: 46,248,767 (GRCm39) T593A probably benign Het
Spata31e3 A T 13: 50,402,296 (GRCm39) D83E possibly damaging Het
Svs5 A T 2: 164,175,507 (GRCm39) I120L probably benign Het
Tcl1b1 G T 12: 105,126,074 (GRCm39) V19F probably damaging Het
Urgcp T C 11: 5,666,004 (GRCm39) N778S probably benign Het
Vnn1 A T 10: 23,775,499 (GRCm39) I250F possibly damaging Het
Xntrpc A G 7: 101,732,181 (GRCm39) R365G possibly damaging Het
Zfp84 T A 7: 29,470,797 (GRCm39) M1K probably null Het
Zfyve26 G A 12: 79,326,841 (GRCm39) R761C probably damaging Het
Zp3r A G 1: 130,505,621 (GRCm39) probably null Het
Other mutations in Cdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Cdh18 APN 15 23,173,882 (GRCm39) missense probably damaging 0.97
IGL01663:Cdh18 APN 15 23,446,077 (GRCm39) missense possibly damaging 0.92
IGL01758:Cdh18 APN 15 23,474,269 (GRCm39) missense probably benign 0.20
IGL02192:Cdh18 APN 15 23,460,402 (GRCm39) missense probably damaging 1.00
IGL02448:Cdh18 APN 15 23,173,875 (GRCm39) missense probably benign 0.00
IGL02717:Cdh18 APN 15 23,410,801 (GRCm39) nonsense probably null
IGL03241:Cdh18 APN 15 23,227,019 (GRCm39) missense probably benign 0.19
IGL03268:Cdh18 APN 15 23,366,953 (GRCm39) missense probably damaging 1.00
IGL03307:Cdh18 APN 15 23,226,872 (GRCm39) missense probably damaging 1.00
R0316:Cdh18 UTSW 15 23,366,999 (GRCm39) missense probably damaging 1.00
R0462:Cdh18 UTSW 15 23,366,971 (GRCm39) missense probably damaging 1.00
R0607:Cdh18 UTSW 15 23,410,876 (GRCm39) missense probably benign 0.01
R0761:Cdh18 UTSW 15 23,226,838 (GRCm39) missense possibly damaging 0.87
R0973:Cdh18 UTSW 15 23,474,081 (GRCm39) missense probably damaging 0.99
R1550:Cdh18 UTSW 15 23,436,634 (GRCm39) missense probably damaging 1.00
R1656:Cdh18 UTSW 15 23,474,485 (GRCm39) missense probably benign 0.38
R1682:Cdh18 UTSW 15 23,400,671 (GRCm39) missense probably benign 0.05
R1770:Cdh18 UTSW 15 23,474,487 (GRCm39) missense probably benign
R1829:Cdh18 UTSW 15 23,173,938 (GRCm39) missense probably damaging 1.00
R2253:Cdh18 UTSW 15 23,410,891 (GRCm39) missense probably benign 0.00
R2435:Cdh18 UTSW 15 23,367,094 (GRCm39) missense probably damaging 1.00
R3914:Cdh18 UTSW 15 23,410,771 (GRCm39) missense probably damaging 1.00
R3964:Cdh18 UTSW 15 23,474,187 (GRCm39) missense probably benign
R4002:Cdh18 UTSW 15 23,383,048 (GRCm39) missense possibly damaging 0.48
R4291:Cdh18 UTSW 15 22,714,637 (GRCm39) intron probably benign
R4581:Cdh18 UTSW 15 23,226,869 (GRCm39) missense probably damaging 1.00
R4604:Cdh18 UTSW 15 23,474,454 (GRCm39) missense probably benign 0.05
R4625:Cdh18 UTSW 15 22,714,128 (GRCm39) intron probably benign
R4786:Cdh18 UTSW 15 23,410,873 (GRCm39) missense probably null 1.00
R4811:Cdh18 UTSW 15 23,226,877 (GRCm39) missense probably benign 0.30
R5023:Cdh18 UTSW 15 23,259,752 (GRCm39) missense probably damaging 1.00
R5094:Cdh18 UTSW 15 22,714,625 (GRCm39) intron probably benign
R5278:Cdh18 UTSW 15 23,474,244 (GRCm39) missense probably benign 0.04
R5416:Cdh18 UTSW 15 23,226,809 (GRCm39) missense probably damaging 1.00
R5503:Cdh18 UTSW 15 23,436,620 (GRCm39) missense probably damaging 0.96
R5617:Cdh18 UTSW 15 23,226,854 (GRCm39) missense probably damaging 0.97
R5982:Cdh18 UTSW 15 23,474,302 (GRCm39) missense possibly damaging 0.89
R6240:Cdh18 UTSW 15 23,227,022 (GRCm39) missense possibly damaging 0.82
R6475:Cdh18 UTSW 15 23,227,022 (GRCm39) missense possibly damaging 0.82
R6649:Cdh18 UTSW 15 23,436,620 (GRCm39) missense possibly damaging 0.87
R6700:Cdh18 UTSW 15 23,474,191 (GRCm39) missense probably benign
R6718:Cdh18 UTSW 15 23,226,835 (GRCm39) missense probably benign 0.15
R6796:Cdh18 UTSW 15 23,446,159 (GRCm39) missense probably damaging 1.00
R7330:Cdh18 UTSW 15 23,227,036 (GRCm39) missense possibly damaging 0.46
R7429:Cdh18 UTSW 15 23,366,942 (GRCm39) missense possibly damaging 0.89
R7477:Cdh18 UTSW 15 23,410,811 (GRCm39) missense probably benign
R7516:Cdh18 UTSW 15 23,259,684 (GRCm39) splice site probably null
R7519:Cdh18 UTSW 15 23,474,298 (GRCm39) missense possibly damaging 0.68
R7575:Cdh18 UTSW 15 23,400,683 (GRCm39) nonsense probably null
R7618:Cdh18 UTSW 15 23,367,056 (GRCm39) missense probably damaging 1.00
R7844:Cdh18 UTSW 15 23,410,873 (GRCm39) missense probably damaging 1.00
R7870:Cdh18 UTSW 15 23,474,413 (GRCm39) missense possibly damaging 0.94
R8288:Cdh18 UTSW 15 23,446,073 (GRCm39) missense probably damaging 1.00
R8420:Cdh18 UTSW 15 23,474,138 (GRCm39) missense possibly damaging 0.94
R8430:Cdh18 UTSW 15 23,226,770 (GRCm39) missense probably damaging 1.00
R8916:Cdh18 UTSW 15 23,410,813 (GRCm39) missense probably damaging 0.99
R9093:Cdh18 UTSW 15 23,474,064 (GRCm39) missense probably damaging 1.00
R9183:Cdh18 UTSW 15 23,227,065 (GRCm39) critical splice donor site probably null
R9399:Cdh18 UTSW 15 23,173,899 (GRCm39) missense probably damaging 1.00
R9531:Cdh18 UTSW 15 23,436,562 (GRCm39) missense probably benign
Z1189:Cdh18 UTSW 15 23,474,369 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGAAGCTCACTCCGAGACATCAGAC -3'
(R):5'- GGGCACTTGTTTCTACAGGAGCTG -3'

Sequencing Primer
(F):5'- CGAGACATCAGACCTTGTCC -3'
(R):5'- ATTGAGGTCATATCTCCACTTGG -3'
Posted On 2014-01-05