Incidental Mutation 'R1019:Uck1'
ID96700
Institutional Source Beutler Lab
Gene Symbol Uck1
Ensembl Gene ENSMUSG00000002550
Gene Nameuridine-cytidine kinase 1
SynonymsURK1
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32255002-32260159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32256193 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 230 (V230A)
Ref Sequence ENSEMBL: ENSMUSP00000002625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002625] [ENSMUST00000036473]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002625
AA Change: V230A

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002625
Gene: ENSMUSG00000002550
AA Change: V230A

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:CoaE 30 198 1.1e-8 PFAM
Pfam:AAA_17 31 188 3.8e-8 PFAM
Pfam:PRK 31 225 1.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036473
SMART Domains Protein: ENSMUSP00000038722
Gene: ENSMUSG00000039254

DomainStartEndE-ValueType
Pfam:PMT 42 289 2.8e-96 PFAM
MIR 318 381 7.45e-8 SMART
MIR 392 449 1.65e-9 SMART
MIR 456 513 6.2e-5 SMART
Pfam:PMT_4TMC 542 740 3.9e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138000
Predicted Effect probably benign
Transcript: ENSMUST00000138133
SMART Domains Protein: ENSMUSP00000125350
Gene: ENSMUSG00000002550

DomainStartEndE-ValueType
Pfam:PRK 1 151 1e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151598
Predicted Effect probably benign
Transcript: ENSMUST00000192998
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Uck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Uck1 APN 2 32259669 missense probably damaging 1.00
IGL01765:Uck1 APN 2 32258676 unclassified probably benign
IGL02028:Uck1 APN 2 32258137 missense probably damaging 1.00
IGL02863:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03114:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03159:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03325:Uck1 APN 2 32258322 missense probably benign 0.04
PIT4378001:Uck1 UTSW 2 32256034 missense probably damaging 1.00
R1332:Uck1 UTSW 2 32259654 missense probably damaging 1.00
R1336:Uck1 UTSW 2 32259654 missense probably damaging 1.00
R1428:Uck1 UTSW 2 32258355 missense probably damaging 1.00
R2173:Uck1 UTSW 2 32256076 unclassified probably benign
R2233:Uck1 UTSW 2 32258303 missense probably damaging 1.00
R2234:Uck1 UTSW 2 32258303 missense probably damaging 1.00
R2938:Uck1 UTSW 2 32256076 unclassified probably benign
R3079:Uck1 UTSW 2 32258077 unclassified probably benign
R4667:Uck1 UTSW 2 32256034 missense probably damaging 1.00
R5036:Uck1 UTSW 2 32258466 unclassified probably benign
R6463:Uck1 UTSW 2 32258655 missense probably benign 0.00
R7072:Uck1 UTSW 2 32258166 missense probably damaging 1.00
R7690:Uck1 UTSW 2 32258172 missense probably benign 0.03
R8021:Uck1 UTSW 2 32259917 missense probably benign 0.17
R8415:Uck1 UTSW 2 32260141 unclassified probably benign
R8416:Uck1 UTSW 2 32260141 unclassified probably benign
R8437:Uck1 UTSW 2 32260141 unclassified probably benign
R8438:Uck1 UTSW 2 32260141 unclassified probably benign
R8440:Uck1 UTSW 2 32260141 unclassified probably benign
R8442:Uck1 UTSW 2 32260141 unclassified probably benign
R8530:Uck1 UTSW 2 32260141 unclassified probably benign
R8537:Uck1 UTSW 2 32260141 unclassified probably benign
R8749:Uck1 UTSW 2 32256512 missense
Predicted Primers PCR Primer
(F):5'- ATGCTCTGTCAGCATGAGTCTGCC -3'
(R):5'- GCCTTCTGCCTGGTGAGACATAAG -3'

Sequencing Primer
(F):5'- TAGGTCCCACTCATTGAGAGG -3'
(R):5'- GCACCATGAGTGTTTTGCAG -3'
Posted On2014-01-05