Incidental Mutation 'R1019:Tgm2'
ID96706
Institutional Source Beutler Lab
Gene Symbol Tgm2
Ensembl Gene ENSMUSG00000037820
Gene Nametransglutaminase 2, C polypeptide
SynonymstTG, protein-glutamine gamma-glutamyltransferase, TGase2, TG2, TG C, G[a]h, tTGas, tissue transglutaminase
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location158116402-158146436 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 158124154 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 527 (E527*)
Ref Sequence ENSEMBL: ENSMUSP00000099411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103122] [ENSMUST00000152452] [ENSMUST00000174718]
Predicted Effect probably null
Transcript: ENSMUST00000103122
AA Change: E527*
SMART Domains Protein: ENSMUSP00000099411
Gene: ENSMUSG00000037820
AA Change: E527*

DomainStartEndE-ValueType
Pfam:Transglut_N 6 122 3.6e-34 PFAM
TGc 269 361 1.11e-38 SMART
Pfam:Transglut_C 473 572 5.7e-29 PFAM
Pfam:Transglut_C 586 685 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152452
SMART Domains Protein: ENSMUSP00000118434
Gene: ENSMUSG00000027651

DomainStartEndE-ValueType
RPR 8 130 1.71e-53 SMART
low complexity region 132 145 N/A INTRINSIC
PDB:4FLA|D 171 222 3e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174718
SMART Domains Protein: ENSMUSP00000133662
Gene: ENSMUSG00000037820

DomainStartEndE-ValueType
Pfam:Transglut_N 5 124 1.9e-37 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene acts as a monomer, is induced by retinoic acid, and appears to be involved in apoptosis. Finally, the encoded protein is the autoantigen implicated in celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous null mutation causes alterations in glucose and aerobic energy metabolism, tumor growth, and response to myocardial infarction, liver injury, and LPS-induced sepsis. A second null mutation confers resistance to renal injury, while a third one alters cell adhesion and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Tgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Tgm2 APN 2 158124131 missense probably benign
IGL03110:Tgm2 APN 2 158131490 nonsense probably null
IGL03397:Tgm2 APN 2 158120258 missense probably damaging 1.00
R0595:Tgm2 UTSW 2 158143042 missense probably damaging 1.00
R0786:Tgm2 UTSW 2 158124381 missense probably damaging 1.00
R1395:Tgm2 UTSW 2 158124252 missense probably benign 0.01
R1732:Tgm2 UTSW 2 158134357 missense probably damaging 1.00
R1776:Tgm2 UTSW 2 158131459 missense probably benign 0.00
R1863:Tgm2 UTSW 2 158124219 missense probably damaging 1.00
R2863:Tgm2 UTSW 2 158143099 missense probably benign 0.01
R3036:Tgm2 UTSW 2 158124247 missense probably benign 0.00
R4200:Tgm2 UTSW 2 158132490 missense probably benign
R4370:Tgm2 UTSW 2 158124301 nonsense probably null
R4612:Tgm2 UTSW 2 158124204 missense probably benign 0.16
R5100:Tgm2 UTSW 2 158127164 missense probably benign 0.33
R5213:Tgm2 UTSW 2 158143060 missense possibly damaging 0.88
R5253:Tgm2 UTSW 2 158129438 missense probably damaging 1.00
R5585:Tgm2 UTSW 2 158131455 nonsense probably null
R5593:Tgm2 UTSW 2 158127342 missense probably damaging 1.00
R5616:Tgm2 UTSW 2 158128720 missense probably damaging 1.00
R5796:Tgm2 UTSW 2 158118904 missense probably benign 0.00
R5821:Tgm2 UTSW 2 158143054 missense possibly damaging 0.81
R5842:Tgm2 UTSW 2 158143081 missense probably damaging 1.00
R6317:Tgm2 UTSW 2 158124150 missense probably benign 0.18
R6610:Tgm2 UTSW 2 158143100 nonsense probably null
R7134:Tgm2 UTSW 2 158138892 missense probably benign
R7151:Tgm2 UTSW 2 158129395 missense possibly damaging 0.95
R7268:Tgm2 UTSW 2 158120268 nonsense probably null
R7719:Tgm2 UTSW 2 158143118 missense probably damaging 1.00
X0058:Tgm2 UTSW 2 158124147 missense probably benign 0.01
X0067:Tgm2 UTSW 2 158118845 critical splice donor site probably null
Z1177:Tgm2 UTSW 2 158117899 missense not run
Predicted Primers PCR Primer
(F):5'- GGACTGAGAGAGCCAGCAAACTCAT -3'
(R):5'- CACCTGAACAAACTGGCAGAGAAAGA -3'

Sequencing Primer
(F):5'- atcccatagaacacaaaaatccag -3'
(R):5'- CTGGCAGAGAAAGAGGAGAC -3'
Posted On2014-01-05