Mutagenetix > Incidental Mutations

Incidental Mutation 'R1019:Nfatc2'

96709

Institutional Source

Beutler Lab

Gene Symbol

Nfatc2

Ensembl Gene

ENSMUSG00000027544

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2

Synonyms

NFAT1-D, NFATp, NFAT1

MMRRC Submission

039123-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1019 (G1)

Quality Score

122

Status

Not validated

Chromosome

Chromosomal Location

168476410-168601657 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 168504879 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 765 (L765Q)

Ref Sequence

ENSEMBL: ENSMUSP00000104812 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074618] [ENSMUST00000109184]

Predicted Effect

probably damaging
Transcript: ENSMUST00000074618
AA Change: L765Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000074198
Gene: ENSMUSG00000027544
AA Change: L765Q

Domain	Start	End	E-Value	Type
low complexity region	4	22	N/A	INTRINSIC
low complexity region	124	135	N/A	INTRINSIC
low complexity region	170	187	N/A	INTRINSIC
low complexity region	236	255	N/A	INTRINSIC
low complexity region	267	283	N/A	INTRINSIC
Pfam:RHD_DNA_bind	412	572	2.8e-24	PFAM
IPT	579	678	1.65e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109184
AA Change: L765Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104812
Gene: ENSMUSG00000027544
AA Change: L765Q

Domain	Start	End	E-Value	Type
low complexity region	4	22	N/A	INTRINSIC
low complexity region	124	135	N/A	INTRINSIC
low complexity region	170	187	N/A	INTRINSIC
low complexity region	236	255	N/A	INTRINSIC
low complexity region	267	283	N/A	INTRINSIC
Pfam:RHD	412	572	1.3e-24	PFAM
IPT	579	678	1.65e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151292

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nuclear factor of activated T cells (NFAT) family. The product of this gene is a DNA-binding protein with a REL-homology region (RHR) and an NFAT-homology region (NHR). This protein is present in the cytosol and only translocates to the nucleus upon T cell receptor (TCR) stimulation, where it becomes a member of the nuclear factors of activated T cells transcription complex. This complex plays a central role in inducing gene transcription during the immune response. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mutations in this locus cause altered immune system function such as decreased cytokine production by mast cells, increased Th2 responses after infection with a parasite but decreased Th1 responses after myobacterial infection, retarded thymic involutionand massive germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430548M08Rik	G	C	8: 120,145,470	E46Q	probably damaging	Het
9130401M01Rik	A	G	15: 58,022,427	I353T	possibly damaging	Het
A830031A19Rik	G	A	11: 24,049,438	R53C	unknown	Het
Abcc6	T	C	7: 46,014,107	R378G	possibly damaging	Het
Adam10	A	G	9: 70,761,640	N413D	probably benign	Het
Csmd2	T	C	4: 128,522,014	V2712A	probably benign	Het
Dnhd1	T	C	7: 105,709,171	F3289S	probably damaging	Het
Hectd1	A	G	12: 51,748,657	S2330P	probably damaging	Het
Ift74	C	T	4: 94,635,835	A196V	probably benign	Het
Kifc1	G	A	17: 33,884,711	R195C	probably benign	Het
Lipo2	A	T	19: 33,730,857	C252*	probably null	Het
Mrgpra1	C	G	7: 47,335,085	C282S	probably benign	Het
Olfr355	A	G	2: 36,927,752	F121L	probably benign	Het
Olfr541	C	T	7: 140,704,494	P81L	probably damaging	Het
Otof	C	A	5: 30,370,743	V1924L	probably damaging	Het
Pdhb	T	C	14: 8,171,442	Q62R	probably benign	Het
Plbd1	A	G	6: 136,651,905	V55A	probably benign	Het
Poteg	T	A	8: 27,447,824	F3I	possibly damaging	Het
Rptor	A	G	11: 119,843,743	D46G	probably damaging	Het
Slc18a1	C	T	8: 69,075,033		probably null	Het
Slc37a1	A	G	17: 31,315,594	N80S	probably benign	Het
Slc6a18	T	A	13: 73,677,879	R17S	probably damaging	Het
Spata31d1a	A	G	13: 59,702,368	S649P	probably benign	Het
Syngr3	G	T	17: 24,687,560	Q94K	possibly damaging	Het
Tgm2	C	A	2: 158,124,154	E527*	probably null	Het
Tnc	T	A	4: 63,962,082	T1952S	probably damaging	Het
Ubqln3	C	T	7: 104,141,386	R499Q	probably benign	Het
Uck1	A	G	2: 32,256,193	V230A	possibly damaging	Het
Unc13d	G	A	11: 116,068,074	R754C	probably benign	Het
Zfp708	C	T	13: 67,074,098	A73T	probably benign	Het

Other mutations in Nfatc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Nfatc2	APN	2	168504890	missense	probably damaging	1.00
IGL01728:Nfatc2	APN	2	168536242	missense	probably damaging	1.00
IGL02303:Nfatc2	APN	2	168506901	nonsense	probably null
IGL02887:Nfatc2	APN	2	168504450	missense	probably damaging	1.00
IGL03002:Nfatc2	APN	2	168534984	missense	probably damaging	1.00
IGL03297:Nfatc2	APN	2	168536218	missense	probably damaging	0.99
R0347:Nfatc2	UTSW	2	168536290	missense	probably damaging	1.00
R0590:Nfatc2	UTSW	2	168571199	missense	probably damaging	0.99
R0631:Nfatc2	UTSW	2	168590115	missense	probably benign	0.02
R1183:Nfatc2	UTSW	2	168590088	missense	possibly damaging	0.83
R1420:Nfatc2	UTSW	2	168504665	missense	probably benign	0.01
R1977:Nfatc2	UTSW	2	168504459	missense	possibly damaging	0.68
R2306:Nfatc2	UTSW	2	168590103	missense	probably damaging	1.00
R3034:Nfatc2	UTSW	2	168535020	missense	probably damaging	1.00
R3176:Nfatc2	UTSW	2	168506994	missense	possibly damaging	0.51
R3276:Nfatc2	UTSW	2	168506994	missense	possibly damaging	0.51
R3964:Nfatc2	UTSW	2	168504549	missense	probably benign	0.00
R3966:Nfatc2	UTSW	2	168504549	missense	probably benign	0.00
R4669:Nfatc2	UTSW	2	168571490	missense	probably benign
R4864:Nfatc2	UTSW	2	168536392	missense	probably damaging	0.96
R4951:Nfatc2	UTSW	2	168571072	missense	probably damaging	0.98
R5138:Nfatc2	UTSW	2	168536309	missense	probably damaging	1.00
R5145:Nfatc2	UTSW	2	168590067	missense	probably benign	0.25
R5185:Nfatc2	UTSW	2	168570707	missense	possibly damaging	0.48
R5444:Nfatc2	UTSW	2	168534890	intron	probably benign
R5496:Nfatc2	UTSW	2	168536278	missense	probably damaging	1.00
R5728:Nfatc2	UTSW	2	168480249	missense	probably benign
R5791:Nfatc2	UTSW	2	168536393	missense	probably benign	0.28
R6102:Nfatc2	UTSW	2	168519507	intron	probably benign
R6157:Nfatc2	UTSW	2	168519451	intron	probably benign
R6187:Nfatc2	UTSW	2	168480238	missense	probably benign	0.13
R7116:Nfatc2	UTSW	2	168507349	missense	probably benign	0.04
R7218:Nfatc2	UTSW	2	168571264	missense	probably benign	0.01
R7470:Nfatc2	UTSW	2	168523307	nonsense	probably null
R7594:Nfatc2	UTSW	2	168523348	missense	probably damaging	1.00
R7618:Nfatc2	UTSW	2	168534999	missense	probably damaging	1.00
R7653:Nfatc2	UTSW	2	168571145	missense	probably benign	0.01
R8425:Nfatc2	UTSW	2	168536296	missense	probably damaging	1.00
R8485:Nfatc2	UTSW	2	168590092	missense	probably damaging	1.00
R8791:Nfatc2	UTSW	2	168536294	missense	probably damaging	0.99
Z1176:Nfatc2	UTSW	2	168571349	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTCAGCCTCTGACCTTGGTTGATG -3'
(R):5'- CAGAGCCCAGCGATGAGTATGAAC -3'

Sequencing Primer
(F):5'- ACATGATATGCTGGAACTCCTGG -3'
(R):5'- TGGGGAGCCAGCCATATTAC -3'

Posted On

2014-01-05