Incidental Mutation 'R1019:Plbd1'
ID96732
Institutional Source Beutler Lab
Gene Symbol Plbd1
Ensembl Gene ENSMUSG00000030214
Gene Namephospholipase B domain containing 1
Synonyms1100001H23Rik
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location136612070-136661928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136651905 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 55 (V55A)
Ref Sequence ENSEMBL: ENSMUSP00000032336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032336] [ENSMUST00000205021]
Predicted Effect probably benign
Transcript: ENSMUST00000032336
AA Change: V55A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032336
Gene: ENSMUSG00000030214
AA Change: V55A

DomainStartEndE-ValueType
Pfam:Phospholip_B 16 545 3.7e-198 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205021
SMART Domains Protein: ENSMUSP00000144967
Gene: ENSMUSG00000030214

DomainStartEndE-ValueType
Pfam:Phospholip_B 1 75 3.8e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Plbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Plbd1 APN 6 136634470 missense probably benign
IGL02131:Plbd1 APN 6 136661683 utr 5 prime probably benign
R0355:Plbd1 UTSW 6 136641167 missense possibly damaging 0.71
R0762:Plbd1 UTSW 6 136641147 missense probably damaging 1.00
R1456:Plbd1 UTSW 6 136613816 missense probably benign 0.12
R1607:Plbd1 UTSW 6 136612306 missense probably benign 0.04
R1640:Plbd1 UTSW 6 136640125 missense probably benign 0.00
R2166:Plbd1 UTSW 6 136613790 critical splice donor site probably null
R2909:Plbd1 UTSW 6 136634574 missense probably damaging 1.00
R4494:Plbd1 UTSW 6 136613858 missense probably damaging 1.00
R4529:Plbd1 UTSW 6 136651825 missense probably benign 0.04
R4530:Plbd1 UTSW 6 136651825 missense probably benign 0.04
R5206:Plbd1 UTSW 6 136641156 missense probably benign 0.17
R5272:Plbd1 UTSW 6 136640158 missense probably damaging 1.00
R5522:Plbd1 UTSW 6 136617300 missense probably benign 0.31
R5649:Plbd1 UTSW 6 136616989 missense probably benign 0.01
R5879:Plbd1 UTSW 6 136634505 missense probably damaging 1.00
R5940:Plbd1 UTSW 6 136613721 intron probably benign
R6311:Plbd1 UTSW 6 136613947 missense probably benign 0.09
R6590:Plbd1 UTSW 6 136635600 missense probably damaging 1.00
R6657:Plbd1 UTSW 6 136617252 missense probably damaging 0.99
R6690:Plbd1 UTSW 6 136635600 missense probably damaging 1.00
R6842:Plbd1 UTSW 6 136635614 missense probably benign 0.05
R6938:Plbd1 UTSW 6 136616987 missense probably benign 0.00
R7000:Plbd1 UTSW 6 136612838 missense probably benign 0.21
R7214:Plbd1 UTSW 6 136612831 missense probably damaging 1.00
R7654:Plbd1 UTSW 6 136651866 missense possibly damaging 0.47
R7744:Plbd1 UTSW 6 136617246 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGATGGGGCACTTACAGAGC -3'
(R):5'- ACCACTGGACACCTGGATAGGAAC -3'

Sequencing Primer
(F):5'- CTTACAGAGCAGTGAGGTAGCC -3'
(R):5'- tgtagccagagaccagcc -3'
Posted On2014-01-05