Incidental Mutation 'R1111:Nr5a2'
ID96733
Institutional Source Beutler Lab
Gene Symbol Nr5a2
Ensembl Gene ENSMUSG00000026398
Gene Namenuclear receptor subfamily 5, group A, member 2
SynonymsD1Ertd308e, Ftf, LRH-1, UF2-H3B
MMRRC Submission 039184-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1111 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location136842571-136960448 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 136882421 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027649] [ENSMUST00000027649] [ENSMUST00000168126] [ENSMUST00000168126] [ENSMUST00000192357] [ENSMUST00000192357] [ENSMUST00000192929] [ENSMUST00000192929]
Predicted Effect probably null
Transcript: ENSMUST00000027649
SMART Domains Protein: ENSMUSP00000027649
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 104 175 2.85e-40 SMART
Blast:HOLI 196 247 1e-5 BLAST
low complexity region 290 302 N/A INTRINSIC
HOLI 366 529 4.13e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000027649
SMART Domains Protein: ENSMUSP00000027649
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 104 175 2.85e-40 SMART
Blast:HOLI 196 247 1e-5 BLAST
low complexity region 290 302 N/A INTRINSIC
HOLI 366 529 4.13e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168126
SMART Domains Protein: ENSMUSP00000129071
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 43 114 2.85e-40 SMART
low complexity region 229 241 N/A INTRINSIC
HOLI 305 468 4.13e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168126
SMART Domains Protein: ENSMUSP00000129071
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 43 114 2.85e-40 SMART
low complexity region 229 241 N/A INTRINSIC
HOLI 305 468 4.13e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192357
SMART Domains Protein: ENSMUSP00000142219
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 83 154 1.1e-42 SMART
Blast:HOLI 175 226 1e-5 BLAST
low complexity region 269 281 N/A INTRINSIC
HOLI 345 508 1.7e-48 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192357
SMART Domains Protein: ENSMUSP00000142219
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 83 154 1.1e-42 SMART
Blast:HOLI 175 226 1e-5 BLAST
low complexity region 269 281 N/A INTRINSIC
HOLI 345 508 1.7e-48 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192929
SMART Domains Protein: ENSMUSP00000141495
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 43 114 2.85e-40 SMART
low complexity region 229 241 N/A INTRINSIC
HOLI 305 468 4.13e-46 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192929
SMART Domains Protein: ENSMUSP00000141495
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 43 114 2.85e-40 SMART
low complexity region 229 241 N/A INTRINSIC
HOLI 305 468 4.13e-46 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding zinc finger transcription factor and is a member of the fushi tarazu factor-1 subfamily of orphan nuclear receptors. The encoded protein is involved in the expression of genes for hepatitis B virus and cholesterol biosynthesis, and may be an important regulator of embryonic development. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene die around embryonic day 7.5. Heterozygotes are essentially normal but with lower plasma cholesterol, increased bile acids, and shorter intestinal crypt length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,967,660 N421K probably damaging Het
Crip2 C T 12: 113,144,074 Q86* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcp T C 6: 29,485,423 S1191G probably benign Het
Olfr829 A T 9: 18,857,592 *313C probably null Het
Rdm1 T C 11: 101,633,895 V218A probably benign Het
Slc22a4 T C 11: 54,007,841 T142A probably benign Het
Tgfbrap1 G A 1: 43,051,976 A663V probably benign Het
Togaram1 A G 12: 65,006,341 N1282D probably damaging Het
Zfp687 T C 3: 95,009,512 S768G probably damaging Het
Other mutations in Nr5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Nr5a2 APN 1 136890798 missense probably damaging 1.00
IGL01082:Nr5a2 APN 1 136845468 missense probably benign 0.06
IGL02547:Nr5a2 APN 1 136940927 missense probably benign 0.01
IGL02688:Nr5a2 APN 1 136940407 critical splice donor site probably null
IGL02712:Nr5a2 APN 1 136940528 splice site probably null
aggressivity UTSW 1 136882344 missense possibly damaging 0.78
R0356:Nr5a2 UTSW 1 136845692 missense possibly damaging 0.91
R0653:Nr5a2 UTSW 1 136948805 missense probably benign 0.04
R1728:Nr5a2 UTSW 1 136952125 missense probably benign
R1729:Nr5a2 UTSW 1 136952125 missense probably benign
R1730:Nr5a2 UTSW 1 136952125 missense probably benign
R1739:Nr5a2 UTSW 1 136952125 missense probably benign
R1762:Nr5a2 UTSW 1 136952125 missense probably benign
R1783:Nr5a2 UTSW 1 136952125 missense probably benign
R1784:Nr5a2 UTSW 1 136952125 missense probably benign
R1785:Nr5a2 UTSW 1 136952125 missense probably benign
R1927:Nr5a2 UTSW 1 136944994 missense probably damaging 1.00
R2360:Nr5a2 UTSW 1 136948827 missense probably benign
R3408:Nr5a2 UTSW 1 136940498 missense probably benign
R4662:Nr5a2 UTSW 1 136940429 missense probably benign 0.00
R4861:Nr5a2 UTSW 1 136948720 critical splice donor site probably null
R4861:Nr5a2 UTSW 1 136948720 critical splice donor site probably null
R5176:Nr5a2 UTSW 1 136948802 start codon destroyed probably null 0.96
R5999:Nr5a2 UTSW 1 136845542 missense probably damaging 1.00
R6191:Nr5a2 UTSW 1 136890798 missense probably damaging 1.00
R6457:Nr5a2 UTSW 1 136960238 missense probably benign 0.00
R6747:Nr5a2 UTSW 1 136882344 missense possibly damaging 0.78
R8170:Nr5a2 UTSW 1 136940647 missense probably benign 0.06
X0012:Nr5a2 UTSW 1 136943292 missense probably damaging 1.00
X0065:Nr5a2 UTSW 1 136940777 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAACAGCACCAGGAACTTGAGAC -3'
(R):5'- TCAGCATCATTGGGAAGCCCTTTAC -3'

Sequencing Primer
(F):5'- TTGAGACATACAAACTCCCGCTG -3'
(R):5'- GATGTTGTCAACTTGAGCCAC -3'
Posted On2014-01-05