Incidental Mutation 'R1019:Mrgpra1'
ID96742
Institutional Source Beutler Lab
Gene Symbol Mrgpra1
Ensembl Gene ENSMUSG00000050650
Gene NameMAS-related GPR, member A1
SynonymsMrgA1
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location47334875-47354240 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 47335085 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 282 (C282S)
Ref Sequence ENSEMBL: ENSMUSP00000129978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098438]
Predicted Effect probably benign
Transcript: ENSMUST00000098438
AA Change: C282S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000129978
Gene: ENSMUSG00000050650
AA Change: C282S

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 36 49 N/A INTRINSIC
Pfam:7tm_1 57 225 2.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Mrgpra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Mrgpra1 APN 7 47335578 missense probably benign 0.00
IGL01317:Mrgpra1 APN 7 47335624 missense probably benign 0.00
IGL01718:Mrgpra1 APN 7 47335927 splice site probably null
IGL02252:Mrgpra1 APN 7 47335164 missense probably benign 0.00
IGL03301:Mrgpra1 APN 7 47335416 missense probably benign
R0012:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R2224:Mrgpra1 UTSW 7 47335106 missense possibly damaging 0.50
R2520:Mrgpra1 UTSW 7 47335272 missense possibly damaging 0.75
R2924:Mrgpra1 UTSW 7 47334870 unclassified probably null
R3038:Mrgpra1 UTSW 7 47334996 nonsense probably null
R3900:Mrgpra1 UTSW 7 47335527 missense possibly damaging 0.76
R4692:Mrgpra1 UTSW 7 47335698 missense probably damaging 1.00
R4783:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R4784:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R4785:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R4981:Mrgpra1 UTSW 7 47335211 missense probably damaging 1.00
R5031:Mrgpra1 UTSW 7 47335237 nonsense probably null
R6760:Mrgpra1 UTSW 7 47335041 missense probably benign 0.03
R7305:Mrgpra1 UTSW 7 47335455 missense probably benign 0.38
R7348:Mrgpra1 UTSW 7 47335409 missense probably benign 0.09
R7837:Mrgpra1 UTSW 7 47335328 missense possibly damaging 0.68
R7920:Mrgpra1 UTSW 7 47335328 missense possibly damaging 0.68
X0012:Mrgpra1 UTSW 7 47335875 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAAAGGCTCTTCATCATGGCTCTG -3'
(R):5'- GGCATTGAGCTTCTTTACTGCTGC -3'

Sequencing Primer
(F):5'- ATGGCTCTGATTTGCTTCTTGAC -3'
(R):5'- TACTGGGCAGATAAAGCTTACC -3'
Posted On2014-01-05