Mutagenetix > Incidental Mutation

Incidental Mutation 'R1111:Kcp'

96745

Institutional Source

Beutler Lab

Gene Symbol

Kcp

Ensembl Gene

ENSMUSG00000059022

Gene Name

kielin/chordin-like protein

Synonyms

Crim2, LOC333088, KCP

MMRRC Submission

039184-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R1111 (G1)

Quality Score

136

Status

Not validated

Chromosome

Chromosomal Location

29473161-29507951 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29485422 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1191 (S1191G)

Ref Sequence

ENSEMBL: ENSMUSP00000099135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479]

AlphaFold

Q3U492

Predicted Effect

probably benign
Transcript: ENSMUST00000078112
AA Change: S1191G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022
AA Change: S1191G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
Pfam:VWD	1214	1254	4.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000091391
AA Change: S1190G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022
AA Change: S1190G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1082	6.53e-9	SMART
VWC	1089	1142	1.05e-3	SMART
VWC	1149	1206	2.93e-11	SMART
Pfam:VWD	1213	1253	4.6e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000101614
AA Change: S1191G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: S1191G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	8e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
VWD	1201	1362	6.09e-50	SMART
C8	1404	1479	1.55e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158018

Predicted Effect

probably benign
Transcript: ENSMUST00000159479

SMART Domains

Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
VWC	1	51	4.56e-1	SMART
VWC	54	110	1.98e-8	SMART
VWC	113	169	1.35e-1	SMART
VWC	172	228	5.77e-10	SMART
VWC	231	286	1.21e-3	SMART
VWC	289	353	6.53e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159482

Predicted Effect

probably benign
Transcript: ENSMUST00000161276

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161655

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 91.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 11 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adsl	T	A	15: 80,851,861 (GRCm39)	N421K	probably damaging	Het
Crip2	C	T	12: 113,107,694 (GRCm39)	Q86*	probably null	Het
Fabp3	C	T	4: 130,206,180 (GRCm39)	T57I	probably benign	Het
Gtf3c3	C	T	1: 54,456,937 (GRCm39)	A488T	probably damaging	Het
Nr5a2	A	T	1: 136,810,159 (GRCm39)		probably null	Het
Or7g17	A	T	9: 18,768,888 (GRCm39)	*313C	probably null	Het
Rdm1	T	C	11: 101,524,721 (GRCm39)	V218A	probably benign	Het
Slc22a4	T	C	11: 53,898,667 (GRCm39)	T142A	probably benign	Het
Tgfbrap1	G	A	1: 43,091,136 (GRCm39)	A663V	probably benign	Het
Togaram1	A	G	12: 65,053,115 (GRCm39)	N1282D	probably damaging	Het
Zfp687	T	C	3: 94,916,823 (GRCm39)	S768G	probably damaging	Het

Other mutations in Kcp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Kcp	APN	6	29,482,656 (GRCm39)	missense	probably benign
IGL01344:Kcp	APN	6	29,498,950 (GRCm39)	splice site	probably null
IGL01404:Kcp	APN	6	29,496,638 (GRCm39)	missense	probably damaging	0.99
IGL01735:Kcp	APN	6	29,498,878 (GRCm39)	missense	probably damaging	1.00
IGL01776:Kcp	APN	6	29,497,907 (GRCm39)	missense	probably damaging	1.00
IGL02092:Kcp	APN	6	29,489,031 (GRCm39)	critical splice donor site	probably null
IGL02252:Kcp	APN	6	29,504,548 (GRCm39)	missense	probably damaging	1.00
IGL02690:Kcp	APN	6	29,484,998 (GRCm39)	unclassified	probably benign
IGL02817:Kcp	APN	6	29,496,968 (GRCm39)	missense	probably damaging	0.97
IGL03074:Kcp	APN	6	29,496,630 (GRCm39)	missense	probably damaging	1.00
P0045:Kcp	UTSW	6	29,498,347 (GRCm39)	missense	probably damaging	1.00
R0219:Kcp	UTSW	6	29,495,784 (GRCm39)	missense	probably damaging	1.00
R0355:Kcp	UTSW	6	29,496,926 (GRCm39)	missense	possibly damaging	0.89
R0738:Kcp	UTSW	6	29,490,438 (GRCm39)	missense	probably benign	0.24
R1304:Kcp	UTSW	6	29,501,291 (GRCm39)	unclassified	probably benign
R1663:Kcp	UTSW	6	29,498,964 (GRCm39)	missense	possibly damaging	0.68
R1808:Kcp	UTSW	6	29,505,654 (GRCm39)	missense	probably benign	0.05
R1907:Kcp	UTSW	6	29,497,834 (GRCm39)	unclassified	probably benign
R2030:Kcp	UTSW	6	29,489,071 (GRCm39)	missense	probably damaging	1.00
R2099:Kcp	UTSW	6	29,496,164 (GRCm39)	nonsense	probably null
R3411:Kcp	UTSW	6	29,482,845 (GRCm39)	missense	possibly damaging	0.68
R3982:Kcp	UTSW	6	29,484,636 (GRCm39)	missense	probably damaging	1.00
R3983:Kcp	UTSW	6	29,484,636 (GRCm39)	missense	probably damaging	1.00
R4223:Kcp	UTSW	6	29,482,257 (GRCm39)	missense	possibly damaging	0.55
R4377:Kcp	UTSW	6	29,493,202 (GRCm39)	missense	probably damaging	1.00
R4570:Kcp	UTSW	6	29,491,847 (GRCm39)	nonsense	probably null
R4624:Kcp	UTSW	6	29,482,813 (GRCm39)	missense	possibly damaging	0.94
R4694:Kcp	UTSW	6	29,493,196 (GRCm39)	missense	probably benign	0.29
R4750:Kcp	UTSW	6	29,484,625 (GRCm39)	missense	probably benign	0.03
R4968:Kcp	UTSW	6	29,497,628 (GRCm39)	nonsense	probably null
R5053:Kcp	UTSW	6	29,496,957 (GRCm39)	missense	probably benign	0.01
R5067:Kcp	UTSW	6	29,492,107 (GRCm39)	missense	probably benign	0.06
R5253:Kcp	UTSW	6	29,498,519 (GRCm39)	unclassified	probably benign
R5418:Kcp	UTSW	6	29,504,283 (GRCm39)	nonsense	probably null
R6020:Kcp	UTSW	6	29,502,863 (GRCm39)	missense	probably benign	0.03
R6033:Kcp	UTSW	6	29,493,193 (GRCm39)	missense	probably damaging	1.00
R6033:Kcp	UTSW	6	29,493,193 (GRCm39)	missense	probably damaging	1.00
R6088:Kcp	UTSW	6	29,502,631 (GRCm39)	missense	probably benign
R6178:Kcp	UTSW	6	29,482,887 (GRCm39)	missense	possibly damaging	0.68
R6285:Kcp	UTSW	6	29,502,364 (GRCm39)	missense	probably benign	0.21
R6310:Kcp	UTSW	6	29,493,257 (GRCm39)	missense	probably damaging	0.98
R6369:Kcp	UTSW	6	29,484,693 (GRCm39)	missense	probably damaging	1.00
R6860:Kcp	UTSW	6	29,505,719 (GRCm39)	missense	probably benign	0.19
R6949:Kcp	UTSW	6	29,484,611 (GRCm39)	splice site	probably null
R6962:Kcp	UTSW	6	29,482,839 (GRCm39)	missense	probably benign	0.08
R7006:Kcp	UTSW	6	29,499,169 (GRCm39)	missense	probably damaging	1.00
R7138:Kcp	UTSW	6	29,491,861 (GRCm39)	nonsense	probably null
R7141:Kcp	UTSW	6	29,487,511 (GRCm39)	nonsense	probably null
R7153:Kcp	UTSW	6	29,499,014 (GRCm39)	missense	probably damaging	1.00
R7162:Kcp	UTSW	6	29,497,199 (GRCm39)	splice site	probably null
R7334:Kcp	UTSW	6	29,485,511 (GRCm39)	missense	probably damaging	1.00
R7565:Kcp	UTSW	6	29,499,186 (GRCm39)	missense	probably damaging	1.00
R7671:Kcp	UTSW	6	29,496,516 (GRCm39)	missense	probably benign	0.02
R7766:Kcp	UTSW	6	29,496,846 (GRCm39)	missense	probably damaging	0.98
R7781:Kcp	UTSW	6	29,497,764 (GRCm39)	missense	probably damaging	1.00
R8702:Kcp	UTSW	6	29,482,750 (GRCm39)	missense	probably damaging	1.00
R9384:Kcp	UTSW	6	29,496,618 (GRCm39)	critical splice donor site	probably null
R9425:Kcp	UTSW	6	29,489,151 (GRCm39)	missense	probably benign
R9553:Kcp	UTSW	6	29,485,100 (GRCm39)	missense	probably null	1.00
R9752:Kcp	UTSW	6	29,497,754 (GRCm39)	missense	probably damaging	1.00
R9755:Kcp	UTSW	6	29,492,460 (GRCm39)	missense	probably damaging	1.00
Z1176:Kcp	UTSW	6	29,485,011 (GRCm39)	missense	probably benign	0.23
Z1177:Kcp	UTSW	6	29,485,524 (GRCm39)	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- TGGTGGTCTCACTGATCCCTTGAAC -3'
(R):5'- CCTTGTCCAGCAGAACAATGCCTC -3'

Sequencing Primer
(F):5'- GAACCCAGGTTCACCCCC -3'
(R):5'- TGTCCAGAAACACTGCTGTG -3'

Posted On

2014-01-05