Incidental Mutation 'R1019:Ubqln3'
ID 96746
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 039123-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R1019 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103790593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 499 (R499Q)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably benign
Transcript: ENSMUST00000057254
AA Change: R499Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: R499Q

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,872,209 (GRCm39) E46Q probably damaging Het
9130401M01Rik A G 15: 57,885,823 (GRCm39) I353T possibly damaging Het
A830031A19Rik G A 11: 23,999,438 (GRCm39) R53C unknown Het
Abcc6 T C 7: 45,663,531 (GRCm39) R378G possibly damaging Het
Adam10 A G 9: 70,668,922 (GRCm39) N413D probably benign Het
Csmd2 T C 4: 128,415,807 (GRCm39) V2712A probably benign Het
Dnhd1 T C 7: 105,358,378 (GRCm39) F3289S probably damaging Het
Hectd1 A G 12: 51,795,440 (GRCm39) S2330P probably damaging Het
Ift74 C T 4: 94,524,072 (GRCm39) A196V probably benign Het
Kifc1 G A 17: 34,103,685 (GRCm39) R195C probably benign Het
Lipo2 A T 19: 33,708,257 (GRCm39) C252* probably null Het
Mrgpra1 C G 7: 46,984,833 (GRCm39) C282S probably benign Het
Nfatc2 A T 2: 168,346,799 (GRCm39) L765Q probably damaging Het
Or13a26 C T 7: 140,284,407 (GRCm39) P81L probably damaging Het
Or1l8 A G 2: 36,817,764 (GRCm39) F121L probably benign Het
Otof C A 5: 30,528,087 (GRCm39) V1924L probably damaging Het
Pdhb T C 14: 8,171,442 (GRCm38) Q62R probably benign Het
Plbd1 A G 6: 136,628,903 (GRCm39) V55A probably benign Het
Poteg T A 8: 27,937,852 (GRCm39) F3I possibly damaging Het
Rptor A G 11: 119,734,569 (GRCm39) D46G probably damaging Het
Slc18a1 C T 8: 69,527,685 (GRCm39) probably null Het
Slc37a1 A G 17: 31,534,568 (GRCm39) N80S probably benign Het
Slc6a18 T A 13: 73,825,998 (GRCm39) R17S probably damaging Het
Spata31d1a A G 13: 59,850,182 (GRCm39) S649P probably benign Het
Syngr3 G T 17: 24,906,534 (GRCm39) Q94K possibly damaging Het
Tgm2 C A 2: 157,966,074 (GRCm39) E527* probably null Het
Tnc T A 4: 63,880,319 (GRCm39) T1952S probably damaging Het
Uck1 A G 2: 32,146,205 (GRCm39) V230A possibly damaging Het
Unc13d G A 11: 115,958,900 (GRCm39) R754C probably benign Het
Zfp708 C T 13: 67,222,162 (GRCm39) A73T probably benign Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGCTCCAGTTGTACCCGGAAGTG -3'
(R):5'- ATCAAGGGAAAGTCATCATGCCCAG -3'

Sequencing Primer
(F):5'- GGTACTAGCTAAGGCTTGTAACACC -3'
(R):5'- TGGCCCCAGTACTAGCTTG -3'
Posted On 2014-01-05