Incidental Mutation 'R1019:Olfr541'
ID96751
Institutional Source Beutler Lab
Gene Symbol Olfr541
Ensembl Gene ENSMUSG00000057997
Gene Nameolfactory receptor 541
SynonymsGA_x6K02T2PBJ9-42850324-42851256, MOR253-3
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140697267-140705606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 140704494 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 81 (P81L)
Ref Sequence ENSEMBL: ENSMUSP00000148238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080681] [ENSMUST00000209857] [ENSMUST00000210357]
Predicted Effect probably damaging
Transcript: ENSMUST00000080681
AA Change: P81L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079508
Gene: ENSMUSG00000057997
AA Change: P81L

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 2.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 37 180 5e-8 PFAM
Pfam:7tm_1 43 292 1.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209857
AA Change: P81L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000210357
AA Change: P81L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Olfr541
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Olfr541 APN 7 140704437 missense probably damaging 1.00
IGL01872:Olfr541 APN 7 140704263 missense possibly damaging 0.59
IGL02814:Olfr541 APN 7 140705133 missense probably damaging 1.00
R0690:Olfr541 UTSW 7 140704787 missense possibly damaging 0.88
R1665:Olfr541 UTSW 7 140704794 missense probably damaging 1.00
R1696:Olfr541 UTSW 7 140704496 nonsense probably null
R4065:Olfr541 UTSW 7 140704269 missense probably benign
R4517:Olfr541 UTSW 7 140705091 missense probably damaging 1.00
R5549:Olfr541 UTSW 7 140704799 unclassified probably null
R6327:Olfr541 UTSW 7 140704703 missense probably damaging 1.00
R7288:Olfr541 UTSW 7 140705029 nonsense probably null
R7307:Olfr541 UTSW 7 140705147 missense probably benign 0.39
R7454:Olfr541 UTSW 7 140704634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAGAGTTTGGAACCAGCC -3'
(R):5'- GCATTCAGAGCACAGATGGACCAC -3'

Sequencing Primer
(F):5'- TGGAACCAGCCTTTGAACTG -3'
(R):5'- AGAGCCCCACAGAGCTG -3'
Posted On2014-01-05