Incidental Mutation 'R1111:Slc22a4'
ID96753
Institutional Source Beutler Lab
Gene Symbol Slc22a4
Ensembl Gene ENSMUSG00000020334
Gene Namesolute carrier family 22 (organic cation transporter), member 4
SynonymsOctn1
MMRRC Submission 039184-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R1111 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53983123-54028090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54007841 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 142 (T142A)
Ref Sequence ENSEMBL: ENSMUSP00000020586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020586]
Predicted Effect probably benign
Transcript: ENSMUST00000020586
AA Change: T142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020586
Gene: ENSMUSG00000020334
AA Change: T142A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 60 524 2.7e-30 PFAM
Pfam:MFS_1 139 478 1.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146351
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is an organic cation transporter and plasma integral membrane protein containing eleven putative transmembrane domains as well as a nucleotide-binding site motif. Transport by this protein is at least partially ATP-dependent. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete loss of ergothioneine with reduced absorption and increased excretion and increased susceptibility of small intestine to inflammation following ischemia and reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,967,660 N421K probably damaging Het
Crip2 C T 12: 113,144,074 Q86* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcp T C 6: 29,485,423 S1191G probably benign Het
Nr5a2 A T 1: 136,882,421 probably null Het
Olfr829 A T 9: 18,857,592 *313C probably null Het
Rdm1 T C 11: 101,633,895 V218A probably benign Het
Tgfbrap1 G A 1: 43,051,976 A663V probably benign Het
Togaram1 A G 12: 65,006,341 N1282D probably damaging Het
Zfp687 T C 3: 95,009,512 S768G probably damaging Het
Other mutations in Slc22a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Slc22a4 APN 11 53986477 critical splice donor site probably null
IGL01723:Slc22a4 APN 11 53988845 missense probably benign 0.28
IGL01839:Slc22a4 APN 11 53996077 missense probably damaging 0.98
IGL02022:Slc22a4 APN 11 53983609 unclassified probably benign
IGL02386:Slc22a4 APN 11 53988772 splice site probably benign
PIT1430001:Slc22a4 UTSW 11 54027957 missense probably benign
R0001:Slc22a4 UTSW 11 54028003 start gained probably benign
R1710:Slc22a4 UTSW 11 54027975 start codon destroyed probably null 0.99
R2104:Slc22a4 UTSW 11 53983610 unclassified probably benign
R3081:Slc22a4 UTSW 11 54007789 missense probably benign 0.38
R3498:Slc22a4 UTSW 11 53992053 missense probably benign 0.00
R4014:Slc22a4 UTSW 11 53997392 missense probably benign 0.04
R4658:Slc22a4 UTSW 11 53997510 missense probably benign 0.05
R4720:Slc22a4 UTSW 11 53988893 missense probably damaging 1.00
R4727:Slc22a4 UTSW 11 54027651 missense possibly damaging 0.83
R5894:Slc22a4 UTSW 11 53997515 missense probably benign 0.04
R5945:Slc22a4 UTSW 11 53996028 missense probably damaging 1.00
R6295:Slc22a4 UTSW 11 54007808 missense possibly damaging 0.46
R6848:Slc22a4 UTSW 11 54007789 missense possibly damaging 0.90
R6899:Slc22a4 UTSW 11 53988913 missense probably damaging 1.00
R7343:Slc22a4 UTSW 11 53986538 missense possibly damaging 0.53
R7414:Slc22a4 UTSW 11 53997428 missense probably benign 0.00
R7806:Slc22a4 UTSW 11 53990650 missense probably damaging 1.00
R8068:Slc22a4 UTSW 11 53997443 missense possibly damaging 0.89
R8087:Slc22a4 UTSW 11 53996061 missense possibly damaging 0.80
R8218:Slc22a4 UTSW 11 53986581 missense probably benign 0.00
Z1177:Slc22a4 UTSW 11 54027718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTCTTCCCTGTGTAGAAAGCCC -3'
(R):5'- AAGCGGTTAAAGCCATCTCCTTCC -3'

Sequencing Primer
(F):5'- AGCCCATGAATTTGATCTTGTGTC -3'
(R):5'- tcaatgagggactttggcac -3'
Posted On2014-01-05