Incidental Mutation 'R1111:Slc22a4'
ID 96753
Institutional Source Beutler Lab
Gene Symbol Slc22a4
Ensembl Gene ENSMUSG00000020334
Gene Name solute carrier family 22 (organic cation transporter), member 4
Synonyms Octn1
MMRRC Submission 039184-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R1111 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 53873949-53918916 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53898667 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 142 (T142A)
Ref Sequence ENSEMBL: ENSMUSP00000020586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020586]
AlphaFold Q9Z306
Predicted Effect probably benign
Transcript: ENSMUST00000020586
AA Change: T142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020586
Gene: ENSMUSG00000020334
AA Change: T142A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 60 524 2.7e-30 PFAM
Pfam:MFS_1 139 478 1.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146351
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is an organic cation transporter and plasma integral membrane protein containing eleven putative transmembrane domains as well as a nucleotide-binding site motif. Transport by this protein is at least partially ATP-dependent. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete loss of ergothioneine with reduced absorption and increased excretion and increased susceptibility of small intestine to inflammation following ischemia and reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,851,861 (GRCm39) N421K probably damaging Het
Crip2 C T 12: 113,107,694 (GRCm39) Q86* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Kcp T C 6: 29,485,422 (GRCm39) S1191G probably benign Het
Nr5a2 A T 1: 136,810,159 (GRCm39) probably null Het
Or7g17 A T 9: 18,768,888 (GRCm39) *313C probably null Het
Rdm1 T C 11: 101,524,721 (GRCm39) V218A probably benign Het
Tgfbrap1 G A 1: 43,091,136 (GRCm39) A663V probably benign Het
Togaram1 A G 12: 65,053,115 (GRCm39) N1282D probably damaging Het
Zfp687 T C 3: 94,916,823 (GRCm39) S768G probably damaging Het
Other mutations in Slc22a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Slc22a4 APN 11 53,877,303 (GRCm39) critical splice donor site probably null
IGL01723:Slc22a4 APN 11 53,879,671 (GRCm39) missense probably benign 0.28
IGL01839:Slc22a4 APN 11 53,886,903 (GRCm39) missense probably damaging 0.98
IGL02022:Slc22a4 APN 11 53,874,435 (GRCm39) unclassified probably benign
IGL02386:Slc22a4 APN 11 53,879,598 (GRCm39) splice site probably benign
PIT1430001:Slc22a4 UTSW 11 53,918,783 (GRCm39) missense probably benign
R0001:Slc22a4 UTSW 11 53,918,829 (GRCm39) start gained probably benign
R1710:Slc22a4 UTSW 11 53,918,801 (GRCm39) start codon destroyed probably null 0.99
R2104:Slc22a4 UTSW 11 53,874,436 (GRCm39) unclassified probably benign
R3081:Slc22a4 UTSW 11 53,898,615 (GRCm39) missense probably benign 0.38
R3498:Slc22a4 UTSW 11 53,882,879 (GRCm39) missense probably benign 0.00
R4014:Slc22a4 UTSW 11 53,888,218 (GRCm39) missense probably benign 0.04
R4658:Slc22a4 UTSW 11 53,888,336 (GRCm39) missense probably benign 0.05
R4720:Slc22a4 UTSW 11 53,879,719 (GRCm39) missense probably damaging 1.00
R4727:Slc22a4 UTSW 11 53,918,477 (GRCm39) missense possibly damaging 0.83
R5894:Slc22a4 UTSW 11 53,888,341 (GRCm39) missense probably benign 0.04
R5945:Slc22a4 UTSW 11 53,886,854 (GRCm39) missense probably damaging 1.00
R6295:Slc22a4 UTSW 11 53,898,634 (GRCm39) missense possibly damaging 0.46
R6848:Slc22a4 UTSW 11 53,898,615 (GRCm39) missense possibly damaging 0.90
R6899:Slc22a4 UTSW 11 53,879,739 (GRCm39) missense probably damaging 1.00
R7343:Slc22a4 UTSW 11 53,877,364 (GRCm39) missense possibly damaging 0.53
R7414:Slc22a4 UTSW 11 53,888,254 (GRCm39) missense probably benign 0.00
R7806:Slc22a4 UTSW 11 53,881,476 (GRCm39) missense probably damaging 1.00
R8068:Slc22a4 UTSW 11 53,888,269 (GRCm39) missense possibly damaging 0.89
R8087:Slc22a4 UTSW 11 53,886,887 (GRCm39) missense possibly damaging 0.80
R8218:Slc22a4 UTSW 11 53,877,407 (GRCm39) missense probably benign 0.00
R8971:Slc22a4 UTSW 11 53,879,718 (GRCm39) missense probably damaging 0.99
R9008:Slc22a4 UTSW 11 53,881,664 (GRCm39) nonsense probably null
R9296:Slc22a4 UTSW 11 53,888,217 (GRCm39) nonsense probably null
R9484:Slc22a4 UTSW 11 53,879,773 (GRCm39) missense possibly damaging 0.94
R9679:Slc22a4 UTSW 11 53,881,599 (GRCm39) missense probably damaging 1.00
Z1177:Slc22a4 UTSW 11 53,918,544 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTCTTCCCTGTGTAGAAAGCCC -3'
(R):5'- AAGCGGTTAAAGCCATCTCCTTCC -3'

Sequencing Primer
(F):5'- AGCCCATGAATTTGATCTTGTGTC -3'
(R):5'- tcaatgagggactttggcac -3'
Posted On 2014-01-05