Incidental Mutation 'R1111:Rdm1'
ID96755
Institutional Source Beutler Lab
Gene Symbol Rdm1
Ensembl Gene ENSMUSG00000010362
Gene NameRAD52 motif 1
SynonymsRad52b, 2410008M22Rik
MMRRC Submission 039184-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R1111 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101627195-101636100 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101633895 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 218 (V218A)
Ref Sequence ENSEMBL: ENSMUSP00000010506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010506]
Predicted Effect probably benign
Transcript: ENSMUST00000010506
AA Change: V218A

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000010506
Gene: ENSMUSG00000010362
AA Change: V218A

DomainStartEndE-ValueType
RRM 16 94 6.2e-6 SMART
low complexity region 248 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133727
SMART Domains Protein: ENSMUSP00000118996
Gene: ENSMUSG00000010362

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 14 118 1.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155222
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the cellular response to cisplatin, a drug commonly used in chemotherapy. The protein encoded by this gene contains two motifs: a motif found in RAD52, a protein that functions in DNA double-strand breaks and homologous recombination, and an RNA recognition motif (RRM) that is not found in RAD52. The RAD52 motif region in RAD52 is important for protein function and may be involved in DNA binding or oligomerization. Alternatively spliced transcript variants encoding different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,967,660 N421K probably damaging Het
Crip2 C T 12: 113,144,074 Q86* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcp T C 6: 29,485,423 S1191G probably benign Het
Nr5a2 A T 1: 136,882,421 probably null Het
Olfr829 A T 9: 18,857,592 *313C probably null Het
Slc22a4 T C 11: 54,007,841 T142A probably benign Het
Tgfbrap1 G A 1: 43,051,976 A663V probably benign Het
Togaram1 A G 12: 65,006,341 N1282D probably damaging Het
Zfp687 T C 3: 95,009,512 S768G probably damaging Het
Other mutations in Rdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Rdm1 APN 11 101635754 missense possibly damaging 0.58
IGL02153:Rdm1 APN 11 101628454 critical splice donor site probably null
IGL02589:Rdm1 APN 11 101628005 missense possibly damaging 0.80
R0532:Rdm1 UTSW 11 101635835 missense probably benign 0.11
R1532:Rdm1 UTSW 11 101633817 missense probably damaging 1.00
R1618:Rdm1 UTSW 11 101628391 missense possibly damaging 0.83
R1696:Rdm1 UTSW 11 101630868 missense probably benign 0.43
R2205:Rdm1 UTSW 11 101634803 missense probably damaging 1.00
R2921:Rdm1 UTSW 11 101630890 missense possibly damaging 0.90
R2922:Rdm1 UTSW 11 101630890 missense possibly damaging 0.90
R2923:Rdm1 UTSW 11 101630890 missense possibly damaging 0.90
R4327:Rdm1 UTSW 11 101630908 missense probably damaging 1.00
R4329:Rdm1 UTSW 11 101630908 missense probably damaging 1.00
R6364:Rdm1 UTSW 11 101630242 missense probably benign 0.01
R7109:Rdm1 UTSW 11 101633828 missense probably damaging 1.00
R8063:Rdm1 UTSW 11 101630868 missense probably benign 0.43
X0010:Rdm1 UTSW 11 101627970 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- CGCTTCTACAGTGAACACTGAGCC -3'
(R):5'- GAAGCTTGAGGGTAACAGCCTGTC -3'

Sequencing Primer
(F):5'- TGAACACTGAGCCCTCAGC -3'
(R):5'- ggctgtcctggaactcac -3'
Posted On2014-01-05