Incidental Mutation 'R1019:Poteg'
ID96756
Institutional Source Beutler Lab
Gene Symbol Poteg
Ensembl Gene ENSMUSG00000063932
Gene NamePOTE ankyrin domain family, member G
Synonyms
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location27447670-27495172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27447824 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 3 (F3I)
Ref Sequence ENSEMBL: ENSMUSP00000080069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081321] [ENSMUST00000209669] [ENSMUST00000210427]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081321
AA Change: F3I

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080069
Gene: ENSMUSG00000063932
AA Change: F3I

DomainStartEndE-ValueType
ANK 80 109 1.46e-2 SMART
ANK 113 142 7.89e1 SMART
ANK 146 175 3.1e-6 SMART
ANK 179 208 2.81e-4 SMART
ANK 212 241 8.62e1 SMART
ANK 245 273 1.23e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209669
Predicted Effect probably benign
Transcript: ENSMUST00000210427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211657
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Poteg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Poteg APN 8 27473620 splice site probably benign
IGL01964:Poteg APN 8 27448008 missense probably damaging 0.99
IGL03017:Poteg APN 8 27462041 missense probably benign 0.01
R0034:Poteg UTSW 8 27462077 splice site probably benign
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0069:Poteg UTSW 8 27447821 missense probably benign 0.33
R0522:Poteg UTSW 8 27449958 missense possibly damaging 0.95
R0634:Poteg UTSW 8 27473587 missense probably benign 0.20
R0971:Poteg UTSW 8 27447939 missense probably damaging 1.00
R1450:Poteg UTSW 8 27447843 missense probably benign 0.27
R1603:Poteg UTSW 8 27448005 start codon destroyed probably null 0.56
R1650:Poteg UTSW 8 27463785 missense probably benign 0.04
R1656:Poteg UTSW 8 27495032 intron probably benign
R1818:Poteg UTSW 8 27450167 nonsense probably null
R2048:Poteg UTSW 8 27456746 missense probably benign 0.39
R2847:Poteg UTSW 8 27481676 missense probably benign 0.10
R2848:Poteg UTSW 8 27481676 missense probably benign 0.10
R2849:Poteg UTSW 8 27481676 missense probably benign 0.10
R4493:Poteg UTSW 8 27480097 missense possibly damaging 0.68
R4967:Poteg UTSW 8 27494981 intron probably benign
R5051:Poteg UTSW 8 27453329 missense possibly damaging 0.78
R5149:Poteg UTSW 8 27481643 missense possibly damaging 0.93
R5579:Poteg UTSW 8 27448037 missense probably damaging 1.00
R5594:Poteg UTSW 8 27447968 missense probably benign 0.28
R5723:Poteg UTSW 8 27449992 critical splice donor site probably null
R5804:Poteg UTSW 8 27456798 missense probably damaging 1.00
R6685:Poteg UTSW 8 27447905 missense possibly damaging 0.91
R6911:Poteg UTSW 8 27450298 missense probably damaging 0.97
R7044:Poteg UTSW 8 27449895 missense probably damaging 1.00
R7096:Poteg UTSW 8 27473567 missense probably benign 0.00
R7174:Poteg UTSW 8 27453277 missense probably benign 0.36
R7287:Poteg UTSW 8 27453344 missense probably null 0.44
R7560:Poteg UTSW 8 27494960 missense probably benign
R7875:Poteg UTSW 8 27449914 missense probably benign 0.04
R7958:Poteg UTSW 8 27449914 missense probably benign 0.04
X0063:Poteg UTSW 8 27450154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCACCTTTACCCATAGCCTCAG -3'
(R):5'- AGCAGCAACCCTGTGAATATGCCC -3'

Sequencing Primer
(F):5'- TTTACCCATAGCCTCAGAGATG -3'
(R):5'- TGAATATGCCCCAACGGTCTG -3'
Posted On2014-01-05