Incidental Mutation 'R1111:Togaram1'
ID96757
Institutional Source Beutler Lab
Gene Symbol Togaram1
Ensembl Gene ENSMUSG00000035614
Gene NameTOG array regulator of axonemal microtubules 1
SynonymsFam179b, A430041B07Rik
MMRRC Submission 039184-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock #R1111 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location64965804-65022573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65006341 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1282 (N1282D)
Ref Sequence ENSEMBL: ENSMUSP00000070382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066296] [ENSMUST00000223166]
Predicted Effect probably damaging
Transcript: ENSMUST00000066296
AA Change: N1282D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070382
Gene: ENSMUSG00000035614
AA Change: N1282D

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
TOG 339 574 3.38e-23 SMART
low complexity region 804 815 N/A INTRINSIC
low complexity region 988 1001 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1033 1041 N/A INTRINSIC
coiled coil region 1177 1206 N/A INTRINSIC
TOG 1251 1486 4.37e-8 SMART
TOG 1533 1776 1.53e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223166
AA Change: N1332D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,967,660 N421K probably damaging Het
Crip2 C T 12: 113,144,074 Q86* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcp T C 6: 29,485,423 S1191G probably benign Het
Nr5a2 A T 1: 136,882,421 probably null Het
Olfr829 A T 9: 18,857,592 *313C probably null Het
Rdm1 T C 11: 101,633,895 V218A probably benign Het
Slc22a4 T C 11: 54,007,841 T142A probably benign Het
Tgfbrap1 G A 1: 43,051,976 A663V probably benign Het
Zfp687 T C 3: 95,009,512 S768G probably damaging Het
Other mutations in Togaram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Togaram1 APN 12 65006399 missense probably damaging 1.00
IGL01128:Togaram1 APN 12 64980876 missense probably benign 0.01
IGL01406:Togaram1 APN 12 64995578 missense possibly damaging 0.81
IGL01534:Togaram1 APN 12 64966547 missense probably damaging 0.99
IGL01569:Togaram1 APN 12 64982662 missense possibly damaging 0.81
IGL01927:Togaram1 APN 12 64976702 missense probably benign 0.31
IGL02066:Togaram1 APN 12 64983421 missense probably damaging 1.00
IGL02746:Togaram1 APN 12 64966496 nonsense probably null
IGL02878:Togaram1 APN 12 64992626 missense possibly damaging 0.60
IGL02947:Togaram1 APN 12 65021500 missense probably damaging 1.00
IGL02961:Togaram1 APN 12 64966710 missense probably damaging 1.00
PIT4810001:Togaram1 UTSW 12 64983512 missense probably damaging 1.00
R0483:Togaram1 UTSW 12 65007031 missense probably damaging 1.00
R0519:Togaram1 UTSW 12 64966002 unclassified probably benign
R0584:Togaram1 UTSW 12 64967505 missense probably damaging 1.00
R0646:Togaram1 UTSW 12 65021466 missense probably damaging 1.00
R0749:Togaram1 UTSW 12 64982698 missense possibly damaging 0.87
R0891:Togaram1 UTSW 12 64982647 missense probably benign 0.01
R1349:Togaram1 UTSW 12 65011145 missense probably damaging 0.99
R1531:Togaram1 UTSW 12 64966265 missense probably benign 0.01
R1618:Togaram1 UTSW 12 64967073 missense possibly damaging 0.47
R1672:Togaram1 UTSW 12 65021568 missense probably benign 0.00
R1789:Togaram1 UTSW 12 65002635 missense possibly damaging 0.47
R1822:Togaram1 UTSW 12 64995635 missense probably damaging 0.98
R1930:Togaram1 UTSW 12 64966935 missense probably damaging 1.00
R1931:Togaram1 UTSW 12 64966935 missense probably damaging 1.00
R2006:Togaram1 UTSW 12 65019140 missense probably damaging 1.00
R2018:Togaram1 UTSW 12 65002659 missense possibly damaging 0.76
R2304:Togaram1 UTSW 12 64976856 splice site probably null
R2345:Togaram1 UTSW 12 65008632 missense probably benign 0.05
R2407:Togaram1 UTSW 12 64967670 missense probably damaging 1.00
R2853:Togaram1 UTSW 12 65016612 missense probably benign 0.40
R3123:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3124:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3125:Togaram1 UTSW 12 64966344 missense probably damaging 1.00
R3693:Togaram1 UTSW 12 64983509 missense probably benign 0.34
R3857:Togaram1 UTSW 12 64980859 missense possibly damaging 0.64
R3870:Togaram1 UTSW 12 65002645 missense probably benign 0.00
R3871:Togaram1 UTSW 12 65002645 missense probably benign 0.00
R4398:Togaram1 UTSW 12 64980856 missense probably benign
R4578:Togaram1 UTSW 12 65020326 missense probably damaging 1.00
R4579:Togaram1 UTSW 12 64967907 missense probably damaging 1.00
R4621:Togaram1 UTSW 12 64982450 missense possibly damaging 0.87
R4623:Togaram1 UTSW 12 64982450 missense possibly damaging 0.87
R4655:Togaram1 UTSW 12 64967120 missense possibly damaging 0.91
R5080:Togaram1 UTSW 12 64983403 missense probably benign 0.02
R5459:Togaram1 UTSW 12 64967736 missense probably damaging 1.00
R5652:Togaram1 UTSW 12 65016650 missense probably benign 0.13
R5857:Togaram1 UTSW 12 64995557 missense possibly damaging 0.64
R5997:Togaram1 UTSW 12 64995538 missense probably benign 0.00
R6090:Togaram1 UTSW 12 64967801 missense probably benign 0.07
R6117:Togaram1 UTSW 12 64967487 missense probably damaging 1.00
R6221:Togaram1 UTSW 12 64966546 missense probably damaging 1.00
R6505:Togaram1 UTSW 12 64966590 missense possibly damaging 0.78
R6545:Togaram1 UTSW 12 64978207 missense possibly damaging 0.90
R6706:Togaram1 UTSW 12 65002609 missense probably benign 0.16
R7041:Togaram1 UTSW 12 65020386 missense possibly damaging 0.76
R7199:Togaram1 UTSW 12 64995518 missense probably benign
R7284:Togaram1 UTSW 12 65008680 missense probably benign 0.09
R7451:Togaram1 UTSW 12 64996975 missense probably damaging 1.00
R7504:Togaram1 UTSW 12 64992617 missense possibly damaging 0.79
R7560:Togaram1 UTSW 12 65011142 missense possibly damaging 0.52
R7802:Togaram1 UTSW 12 64966984 nonsense probably null
X0021:Togaram1 UTSW 12 64966184 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCTCCTCCTTGCCAGAAAGAAGA -3'
(R):5'- ACACTCAAATCAGGTTATGCAGAGTTGT -3'

Sequencing Primer
(F):5'- ctgctcttctgaaggtcctg -3'
(R):5'- CAGGTTATGCAGAGTTGTCTAAAC -3'
Posted On2014-01-05