Incidental Mutation 'R1019:Slc18a1'
ID96758
Institutional Source Beutler Lab
Gene Symbol Slc18a1
Ensembl Gene ENSMUSG00000036330
Gene Namesolute carrier family 18 (vesicular monoamine), member 1
Synonyms4832416I10Rik
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1019 (G1)
Quality Score190
Status Not validated
Chromosome8
Chromosomal Location69037711-69089235 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 69075033 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037478] [ENSMUST00000148856]
Predicted Effect probably null
Transcript: ENSMUST00000037478
SMART Domains Protein: ENSMUSP00000046924
Gene: ENSMUSG00000036330

DomainStartEndE-ValueType
Pfam:MFS_1 24 430 3.7e-34 PFAM
Pfam:MFS_1 302 508 9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147674
Predicted Effect probably benign
Transcript: ENSMUST00000148856
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The vesicular monoamine transporter acts to accumulate cytosolic monoamines into vesicles, using the proton gradient maintained across the vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (Peter et al., 1993 [PubMed 7905859]). See also SLC18A2 (MIM 193001).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased neuron apoptosis, decreased neuron proliferation and impaired spatial object recognition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Slc18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc18a1 APN 8 69051346 missense probably damaging 1.00
IGL00661:Slc18a1 APN 8 69073731 missense probably benign 0.00
IGL01568:Slc18a1 APN 8 69065626 missense probably damaging 1.00
IGL02199:Slc18a1 APN 8 69043980 missense probably benign 0.03
IGL03011:Slc18a1 APN 8 69038863 missense probably benign
IGL03260:Slc18a1 APN 8 69075114 missense probably benign 0.24
R0349:Slc18a1 UTSW 8 69072101 missense probably damaging 1.00
R1759:Slc18a1 UTSW 8 69065585 missense possibly damaging 0.95
R1928:Slc18a1 UTSW 8 69073812 missense probably benign 0.00
R2058:Slc18a1 UTSW 8 69043961 missense probably damaging 1.00
R4652:Slc18a1 UTSW 8 69043931 missense possibly damaging 0.71
R4724:Slc18a1 UTSW 8 69073649 nonsense probably null
R4818:Slc18a1 UTSW 8 69040299 missense probably damaging 0.99
R6799:Slc18a1 UTSW 8 69040981 missense probably benign 0.05
R6989:Slc18a1 UTSW 8 69038862 missense probably benign 0.01
R7557:Slc18a1 UTSW 8 69065561 missense probably damaging 1.00
R7736:Slc18a1 UTSW 8 69065554 critical splice donor site probably null
R8024:Slc18a1 UTSW 8 69075147 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTATGTCTGCCAAGAAGAGGCTG -3'
(R):5'- CTGCCCTTTCTCCTGTAAAGGTGAC -3'

Sequencing Primer
(F):5'- GGAGTCATTAGTCTCAAGTCTGACAG -3'
(R):5'- TTCTCCTGTAAAGGTGACAGAAGAC -3'
Posted On2014-01-05