Incidental Mutation 'R1111:Crip2'
ID96761
Institutional Source Beutler Lab
Gene Symbol Crip2
Ensembl Gene ENSMUSG00000006356
Gene Namecysteine rich protein 2
SynonymsCrp, ESP1, Hlp, CRP4, 0610010I23Rik
MMRRC Submission 039184-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1111 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113140236-113145506 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 113144074 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 86 (Q86*)
Ref Sequence ENSEMBL: ENSMUSP00000081943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084882] [ENSMUST00000196015] [ENSMUST00000199089] [ENSMUST00000200380]
Predicted Effect probably null
Transcript: ENSMUST00000084882
AA Change: Q86*
SMART Domains Protein: ENSMUSP00000081943
Gene: ENSMUSG00000006356
AA Change: Q86*

DomainStartEndE-ValueType
LIM 4 56 2.08e-12 SMART
low complexity region 104 115 N/A INTRINSIC
LIM 125 177 6.05e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196015
SMART Domains Protein: ENSMUSP00000143009
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 1 53 3e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198597
Predicted Effect probably benign
Transcript: ENSMUST00000199089
SMART Domains Protein: ENSMUSP00000142803
Gene: ENSMUSG00000006360

DomainStartEndE-ValueType
LIM 54 106 9.5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200177
Predicted Effect probably benign
Transcript: ENSMUST00000200380
SMART Domains Protein: ENSMUSP00000143334
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 1 53 3e-16 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display abnormal inflammatory pain responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,967,660 N421K probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Kcp T C 6: 29,485,423 S1191G probably benign Het
Nr5a2 A T 1: 136,882,421 probably null Het
Olfr829 A T 9: 18,857,592 *313C probably null Het
Rdm1 T C 11: 101,633,895 V218A probably benign Het
Slc22a4 T C 11: 54,007,841 T142A probably benign Het
Tgfbrap1 G A 1: 43,051,976 A663V probably benign Het
Togaram1 A G 12: 65,006,341 N1282D probably damaging Het
Zfp687 T C 3: 95,009,512 S768G probably damaging Het
Other mutations in Crip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03035:Crip2 APN 12 113144125 missense probably benign 0.03
R0732:Crip2 UTSW 12 113140558 unclassified probably benign
R1186:Crip2 UTSW 12 113144959 splice site probably benign
R1445:Crip2 UTSW 12 113143504 missense probably damaging 1.00
R1473:Crip2 UTSW 12 113143500 missense probably damaging 0.99
R1541:Crip2 UTSW 12 113144966 missense possibly damaging 0.65
R2270:Crip2 UTSW 12 113144866 missense probably damaging 0.99
R4852:Crip2 UTSW 12 113140584 missense probably damaging 1.00
R6935:Crip2 UTSW 12 113140593 missense probably damaging 1.00
R7461:Crip2 UTSW 12 113144157 critical splice donor site probably null
R7613:Crip2 UTSW 12 113144157 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACGCTGTTTGGACCCAAAGGTAAAG -3'
(R):5'- GTGAATGTGGTGACACTAGAGGCTG -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- CTGAAGGGGTGAAACTGGGTC -3'
Posted On2014-01-05