Incidental Mutation 'R1019:Adam10'
ID96766
Institutional Source Beutler Lab
Gene Symbol Adam10
Ensembl Gene ENSMUSG00000054693
Gene Namea disintegrin and metallopeptidase domain 10
Synonymskuzbanian, 1700031C13Rik, kuz
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location70678997-70780229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70761640 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 413 (N413D)
Ref Sequence ENSEMBL: ENSMUSP00000063839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067880] [ENSMUST00000140205]
Predicted Effect probably benign
Transcript: ENSMUST00000067880
AA Change: N413D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000063839
Gene: ENSMUSG00000054693
AA Change: N413D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 27 156 7.5e-15 PFAM
Pfam:Reprolysin_5 219 434 1e-33 PFAM
Pfam:Reprolysin_4 219 453 2.1e-29 PFAM
Pfam:Reprolysin 221 457 6.1e-8 PFAM
Pfam:Reprolysin_2 240 447 6.5e-39 PFAM
Pfam:Reprolysin_3 244 395 4.6e-27 PFAM
DISIN 467 551 5.99e-23 SMART
transmembrane domain 675 697 N/A INTRINSIC
low complexity region 709 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140205
AA Change: N413D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117162
Gene: ENSMUSG00000054693
AA Change: N413D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 156 5.8e-18 PFAM
Pfam:Reprolysin_5 219 434 2.6e-34 PFAM
Pfam:Reprolysin_4 219 453 4e-30 PFAM
Pfam:Reprolysin 221 457 4.4e-10 PFAM
Pfam:Reprolysin_2 240 447 5.1e-36 PFAM
Pfam:Reprolysin_3 244 395 1.7e-24 PFAM
DISIN 467 513 1.48e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero with multiple defects of the developing central nervous system, somites, and cardiovascular system. [provided by RefSeq, May 2016]
PHENOTYPE: Targeted inactivation of this gene leads to embryonic lethality at E9.5. Embryos homozygous for a knock-out allele display decreased size and multiple abnormalities related to Notch signaling, including defects of the developing central nervous system, somites, and cardiovascular system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Adam10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Adam10 APN 9 70718746 missense possibly damaging 0.92
IGL00582:Adam10 APN 9 70766895 missense possibly damaging 0.54
IGL02021:Adam10 APN 9 70743909 missense possibly damaging 0.60
IGL02149:Adam10 APN 9 70703431 missense probably damaging 1.00
IGL03310:Adam10 APN 9 70778089 missense probably damaging 1.00
PIT4382001:Adam10 UTSW 9 70766081 missense probably damaging 1.00
R0110:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0469:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0510:Adam10 UTSW 9 70748248 missense probably damaging 1.00
R0555:Adam10 UTSW 9 70754234 missense probably damaging 1.00
R0671:Adam10 UTSW 9 70765941 splice site probably benign
R0735:Adam10 UTSW 9 70748251 missense possibly damaging 0.81
R0785:Adam10 UTSW 9 70767888 missense possibly damaging 0.86
R0881:Adam10 UTSW 9 70746237 missense probably damaging 1.00
R1169:Adam10 UTSW 9 70746292 missense probably damaging 0.97
R1779:Adam10 UTSW 9 70776369 splice site probably benign
R2048:Adam10 UTSW 9 70740075 missense possibly damaging 0.89
R2911:Adam10 UTSW 9 70718723 missense probably damaging 0.99
R3890:Adam10 UTSW 9 70768854 missense probably benign 0.00
R4608:Adam10 UTSW 9 70743891 missense probably damaging 0.99
R4609:Adam10 UTSW 9 70740143 missense probably damaging 1.00
R4689:Adam10 UTSW 9 70765954 missense possibly damaging 0.51
R5135:Adam10 UTSW 9 70766074 missense probably damaging 1.00
R5496:Adam10 UTSW 9 70722739 missense probably damaging 1.00
R5499:Adam10 UTSW 9 70740117 missense probably benign 0.16
R6730:Adam10 UTSW 9 70740176 critical splice donor site probably null
R6825:Adam10 UTSW 9 70761602 missense probably damaging 1.00
R6987:Adam10 UTSW 9 70722696 missense probably benign
R7616:Adam10 UTSW 9 70722711 missense possibly damaging 0.81
R7829:Adam10 UTSW 9 70766927 nonsense probably null
R7908:Adam10 UTSW 9 70761764 missense possibly damaging 0.83
R8445:Adam10 UTSW 9 70766921 missense probably benign 0.00
R8447:Adam10 UTSW 9 70748118 missense probably damaging 0.97
R8690:Adam10 UTSW 9 70748223 missense probably damaging 1.00
X0020:Adam10 UTSW 9 70740143 missense probably damaging 1.00
X0064:Adam10 UTSW 9 70765952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAACAGTGGCCCCATAGAGCAAG -3'
(R):5'- AGGCGGGAACTGAGTGGCCTCTTAC -3'

Sequencing Primer
(F):5'- GCCCCATAGAGCAAGTGTTTATC -3'
(R):5'- tcctctgacctccacatacc -3'
Posted On2014-01-05