Incidental Mutation 'R1019:Zfp708'
ID96785
Institutional Source Beutler Lab
Gene Symbol Zfp708
Ensembl Gene ENSMUSG00000058883
Gene Namezinc finger protein 708
Synonyms
MMRRC Submission 039123-MU
Accession Numbers

Ncbi RefSeq: NM_001012325.2, NM_001012448.2, NM_001012449.2; MGI:3040674

Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67069399-67097976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67074098 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 73 (A73T)
Ref Sequence ENSEMBL: ENSMUSP00000105364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109742] [ENSMUST00000109743] [ENSMUST00000186303] [ENSMUST00000190566]
Predicted Effect probably benign
Transcript: ENSMUST00000109742
AA Change: A73T

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105364
Gene: ENSMUSG00000058883
AA Change: A73T

DomainStartEndE-ValueType
KRAB 5 65 3.75e-28 SMART
ZnF_C2H2 81 103 1.12e-3 SMART
ZnF_C2H2 109 131 5.14e-3 SMART
ZnF_C2H2 137 159 1.1e-2 SMART
ZnF_C2H2 165 187 6.78e-3 SMART
ZnF_C2H2 193 215 1.47e-3 SMART
ZnF_C2H2 221 243 7.78e-3 SMART
ZnF_C2H2 249 271 1.95e-3 SMART
ZnF_C2H2 277 299 5.21e-4 SMART
ZnF_C2H2 305 327 7.9e-4 SMART
ZnF_C2H2 333 355 8.34e-3 SMART
ZnF_C2H2 361 383 1.3e-4 SMART
ZnF_C2H2 389 411 4.87e-4 SMART
ZnF_C2H2 417 439 5.14e-3 SMART
ZnF_C2H2 445 467 1.2e-3 SMART
ZnF_C2H2 473 495 1.72e-4 SMART
ZnF_C2H2 501 523 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109743
AA Change: A85T

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105365
Gene: ENSMUSG00000058883
AA Change: A85T

DomainStartEndE-ValueType
KRAB 17 77 3.75e-28 SMART
ZnF_C2H2 93 115 1.12e-3 SMART
ZnF_C2H2 121 143 5.14e-3 SMART
ZnF_C2H2 149 171 1.1e-2 SMART
ZnF_C2H2 177 199 6.78e-3 SMART
ZnF_C2H2 205 227 1.47e-3 SMART
ZnF_C2H2 233 255 7.78e-3 SMART
ZnF_C2H2 261 283 1.95e-3 SMART
ZnF_C2H2 289 311 5.21e-4 SMART
ZnF_C2H2 317 339 7.9e-4 SMART
ZnF_C2H2 345 367 8.34e-3 SMART
ZnF_C2H2 373 395 1.3e-4 SMART
ZnF_C2H2 401 423 4.87e-4 SMART
ZnF_C2H2 429 451 5.14e-3 SMART
ZnF_C2H2 457 479 1.2e-3 SMART
ZnF_C2H2 485 507 1.72e-4 SMART
ZnF_C2H2 513 535 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185954
Predicted Effect probably benign
Transcript: ENSMUST00000186303
SMART Domains Protein: ENSMUSP00000140296
Gene: ENSMUSG00000100235

DomainStartEndE-ValueType
KRAB 1 32 9.7e-3 SMART
ZnF_C2H2 47 69 1.8e-6 SMART
ZnF_C2H2 75 97 6.7e-5 SMART
ZnF_C2H2 103 125 7.6e-6 SMART
ZnF_C2H2 131 153 7.6e-6 SMART
ZnF_C2H2 159 181 1.4e-7 SMART
ZnF_C2H2 187 209 7.6e-6 SMART
ZnF_C2H2 215 237 5.5e-5 SMART
ZnF_C2H2 243 265 8.9e-7 SMART
ZnF_C2H2 271 293 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190566
AA Change: A40T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139928
Gene: ENSMUSG00000058883
AA Change: A40T

DomainStartEndE-ValueType
KRAB 1 32 1.6e-3 SMART
ZnF_C2H2 48 70 4.7e-6 SMART
ZnF_C2H2 76 98 2.1e-5 SMART
ZnF_C2H2 104 126 4.6e-5 SMART
ZnF_C2H2 132 154 2.9e-5 SMART
ZnF_C2H2 160 182 6.3e-6 SMART
ZnF_C2H2 188 210 3.3e-5 SMART
ZnF_C2H2 216 238 8.2e-6 SMART
ZnF_C2H2 244 266 2.2e-6 SMART
ZnF_C2H2 272 294 3.4e-6 SMART
ZnF_C2H2 300 322 3.6e-5 SMART
ZnF_C2H2 328 350 5.5e-7 SMART
ZnF_C2H2 356 378 2.1e-6 SMART
ZnF_C2H2 384 406 2.1e-5 SMART
ZnF_C2H2 412 434 5e-6 SMART
ZnF_C2H2 440 462 7.2e-7 SMART
ZnF_C2H2 468 490 6.8e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224641
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Other mutations in Zfp708
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0024:Zfp708 UTSW 13 67070920 nonsense probably null
R0611:Zfp708 UTSW 13 67070311 missense probably benign 0.18
R0627:Zfp708 UTSW 13 67070717 nonsense probably null
R2230:Zfp708 UTSW 13 67070972 nonsense probably null
R2512:Zfp708 UTSW 13 67071187 missense probably damaging 1.00
R5718:Zfp708 UTSW 13 67070458 missense probably benign 0.44
R6128:Zfp708 UTSW 13 67074901 missense probably damaging 1.00
R6644:Zfp708 UTSW 13 67070721 missense possibly damaging 0.88
R6720:Zfp708 UTSW 13 67071432 missense probably damaging 1.00
R7082:Zfp708 UTSW 13 67071136 missense possibly damaging 0.60
R7885:Zfp708 UTSW 13 67074129 missense probably benign
R7968:Zfp708 UTSW 13 67074129 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTACATGCCAGCCTGAATGAACAC -3'
(R):5'- TCAGTAGCCTGAGGCACAGAACAC -3'

Sequencing Primer
(F):5'- AGGACTTTAGCAGCCACTG -3'
(R):5'- GCATCCTGTCTTTCAGGAAATG -3'
Posted On2014-01-05