Incidental Mutation 'R1112:Dusp10'
ID96794
Institutional Source Beutler Lab
Gene Symbol Dusp10
Ensembl Gene ENSMUSG00000039384
Gene Namedual specificity phosphatase 10
SynonymsMKP5, 2610306G15Rik, MKP-5
MMRRC Submission 039185-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R1112 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location184013302-184075636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 184036900 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 21 (Q21L)
Ref Sequence ENSEMBL: ENSMUSP00000045838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048655] [ENSMUST00000050306] [ENSMUST00000139839]
Predicted Effect probably damaging
Transcript: ENSMUST00000048655
AA Change: Q21L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045838
Gene: ENSMUSG00000039384
AA Change: Q21L

DomainStartEndE-ValueType
low complexity region 33 59 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
RHOD 159 283 1.71e-11 SMART
DSPc 322 462 1.43e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050306
SMART Domains Protein: ENSMUSP00000055787
Gene: ENSMUSG00000044854

DomainStartEndE-ValueType
SCOP:d1howa_ 12 46 7e-3 SMART
low complexity region 81 115 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139839
AA Change: Q21L

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121433
Gene: ENSMUSG00000039384
AA Change: Q21L

DomainStartEndE-ValueType
low complexity region 33 59 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193919
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual specificity protein phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the MAP kinase superfamily, which is associated with cellular proliferation and differentiation. Different members of this family of dual specificity phosphatases show distinct substrate specificities for MAP kinases, different tissue distribution and subcellular localization, and different modes of expression induction by extracellular stimuli. This gene product binds to and inactivates p38 and SAPK/JNK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display alterations in both innate and adaptive immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,713,572 N122D probably benign Het
Atrn A G 2: 130,999,161 D1161G probably benign Het
Bscl2 G C 19: 8,839,734 G9R possibly damaging Het
Clstn2 T C 9: 97,458,228 N697S possibly damaging Het
Ctnnd2 T C 15: 30,921,880 V884A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam172a A G 13: 77,761,886 Y40C probably damaging Het
Foxn1 A G 11: 78,371,030 F171S probably benign Het
Fxr2 A G 11: 69,652,248 S624G probably damaging Het
Gorasp2 C A 2: 70,690,814 P376Q probably benign Het
Gpr33 A G 12: 52,023,372 S295P probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hap1 C T 11: 100,354,317 V23M probably damaging Het
Hsd3b5 C T 3: 98,630,077 R41Q probably benign Het
Kif1c T G 11: 70,724,815 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd A G 2: 91,143,599 C1447R probably damaging Het
Myef2 A C 2: 125,097,586 M426R probably damaging Het
Myh13 A T 11: 67,354,750 D1072V probably damaging Het
Olfr394 A C 11: 73,888,234 L46R probably damaging Het
Olfr586 C T 7: 103,122,404 D123N probably damaging Het
Orc4 A T 2: 48,933,572 N90K probably damaging Het
Padi4 C T 4: 140,758,116 S246N probably benign Het
Pcdhb22 A T 18: 37,519,768 T430S possibly damaging Het
Prkd3 T C 17: 78,966,408 D473G probably damaging Het
Scn4a T C 11: 106,320,466 Y1575C probably damaging Het
Serpinb6d A G 13: 33,669,135 Y170C probably damaging Het
Slc12a2 A T 18: 57,937,752 I1059L probably benign Het
Slc36a4 T A 9: 15,723,515 F118I possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srpr A G 9: 35,214,959 T483A probably benign Het
Sycp2 A T 2: 178,352,536 D1198E probably benign Het
Ubash3b T C 9: 41,028,116 N287D probably damaging Het
Uggt1 T C 1: 36,173,546 D905G possibly damaging Het
Zfp692 T C 11: 58,311,562 L381P probably damaging Het
Other mutations in Dusp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Dusp10 APN 1 184069131 missense probably benign 0.00
IGL01094:Dusp10 APN 1 184037500 unclassified probably null
IGL01380:Dusp10 APN 1 184069014 missense possibly damaging 0.93
FR4449:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4548:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4737:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4976:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
LCD18:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
R0369:Dusp10 UTSW 1 184069056 missense probably damaging 1.00
R0433:Dusp10 UTSW 1 184069196 missense probably damaging 1.00
R0464:Dusp10 UTSW 1 184069076 missense probably benign 0.01
R1474:Dusp10 UTSW 1 184037448 unclassified probably null
R1667:Dusp10 UTSW 1 184036858 missense probably damaging 1.00
R1719:Dusp10 UTSW 1 184037225 missense probably benign 0.22
R1899:Dusp10 UTSW 1 184069180 missense possibly damaging 0.64
R5238:Dusp10 UTSW 1 184037013 missense possibly damaging 0.94
R5277:Dusp10 UTSW 1 184037007 missense possibly damaging 0.94
R5742:Dusp10 UTSW 1 184037656 splice site probably null
R5948:Dusp10 UTSW 1 184068876 missense probably benign
R6890:Dusp10 UTSW 1 184069196 missense probably damaging 1.00
R6969:Dusp10 UTSW 1 184068888 missense probably damaging 1.00
R7007:Dusp10 UTSW 1 184037217 missense probably benign 0.22
R7033:Dusp10 UTSW 1 184037605 missense possibly damaging 0.94
R7436:Dusp10 UTSW 1 184069221 missense probably damaging 1.00
R7447:Dusp10 UTSW 1 184068956 missense probably benign
R7479:Dusp10 UTSW 1 184037420 missense probably damaging 0.99
R7572:Dusp10 UTSW 1 184074309 missense probably damaging 1.00
Z1177:Dusp10 UTSW 1 184068992 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTTTACCTCCACTAAGGCTGAAC -3'
(R):5'- AGTGCTGCTGCATCCGCAATTC -3'

Sequencing Primer
(F):5'- CTCAGAGATATGCAGAGGTCTTCC -3'
(R):5'- TGCATCCGCAATTCAGGGAG -3'
Posted On2014-01-05