Incidental Mutation 'R1019:Syngr3'
ID96797
Institutional Source Beutler Lab
Gene Symbol Syngr3
Ensembl Gene ENSMUSG00000007021
Gene Namesynaptogyrin 3
Synonyms
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1019 (G1)
Quality Score136
Status Not validated
Chromosome17
Chromosomal Location24685092-24689955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24687560 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 94 (Q94K)
Ref Sequence ENSEMBL: ENSMUSP00000007236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007236]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007236
AA Change: Q94K

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000007236
Gene: ENSMUSG00000007021
AA Change: Q94K

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:MARVEL 20 166 4.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130936
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein. The exact function of this protein is unclear, but studies of a similar murine protein suggest that it is a synaptic vesicle protein that also interacts with the dopamine transporter. The gene product belongs to the synaptogyrin gene family. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Syngr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02554:Syngr3 APN 17 24686328 missense probably benign 0.00
IGL02739:Syngr3 APN 17 24686398 missense probably damaging 0.99
R0568:Syngr3 UTSW 17 24686581 missense probably benign 0.00
R1398:Syngr3 UTSW 17 24686440 missense probably benign 0.00
R1547:Syngr3 UTSW 17 24687724 missense probably damaging 0.98
R1564:Syngr3 UTSW 17 24686668 splice site probably null
R1819:Syngr3 UTSW 17 24687722 missense possibly damaging 0.85
R1946:Syngr3 UTSW 17 24687706 missense probably benign 0.26
R4094:Syngr3 UTSW 17 24689843 unclassified probably benign
R5755:Syngr3 UTSW 17 24686535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGTGCTTTCAACTCAAGACTTCC -3'
(R):5'- TTGTCAACGAGGGCTACGTGAAC -3'

Sequencing Primer
(F):5'- GGTTTTCCCAAAAGAATCAGGCTC -3'
(R):5'- TACGTGAACTCCGACAGTG -3'
Posted On2014-01-05