Incidental Mutation 'R1112:Atrn'
ID 96806
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
MMRRC Submission 039185-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1112 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 130906495-131030333 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 130999161 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1161 (D1161G)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably benign
Transcript: ENSMUST00000028781
AA Change: D1161G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: D1161G

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151364
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,713,572 N122D probably benign Het
Bscl2 G C 19: 8,839,734 G9R possibly damaging Het
Clstn2 T C 9: 97,458,228 N697S possibly damaging Het
Ctnnd2 T C 15: 30,921,880 V884A probably damaging Het
Dusp10 A T 1: 184,036,900 Q21L probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam172a A G 13: 77,761,886 Y40C probably damaging Het
Foxn1 A G 11: 78,371,030 F171S probably benign Het
Fxr2 A G 11: 69,652,248 S624G probably damaging Het
Gorasp2 C A 2: 70,690,814 P376Q probably benign Het
Gpr33 A G 12: 52,023,372 S295P probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hap1 C T 11: 100,354,317 V23M probably damaging Het
Hsd3b5 C T 3: 98,630,077 R41Q probably benign Het
Kif1c T G 11: 70,724,815 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd A G 2: 91,143,599 C1447R probably damaging Het
Myef2 A C 2: 125,097,586 M426R probably damaging Het
Myh13 A T 11: 67,354,750 D1072V probably damaging Het
Olfr394 A C 11: 73,888,234 L46R probably damaging Het
Olfr586 C T 7: 103,122,404 D123N probably damaging Het
Orc4 A T 2: 48,933,572 N90K probably damaging Het
Padi4 C T 4: 140,758,116 S246N probably benign Het
Pcdhb22 A T 18: 37,519,768 T430S possibly damaging Het
Prkd3 T C 17: 78,966,408 D473G probably damaging Het
Scn4a T C 11: 106,320,466 Y1575C probably damaging Het
Serpinb6d A G 13: 33,669,135 Y170C probably damaging Het
Slc12a2 A T 18: 57,937,752 I1059L probably benign Het
Slc36a4 T A 9: 15,723,515 F118I possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srpr A G 9: 35,214,959 T483A probably benign Het
Sycp2 A T 2: 178,352,536 D1198E probably benign Het
Ubash3b T C 9: 41,028,116 N287D probably damaging Het
Uggt1 T C 1: 36,173,546 D905G possibly damaging Het
Zfp692 T C 11: 58,311,562 L381P probably damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
BB010:Atrn UTSW 2 130995066 missense probably damaging 1.00
BB020:Atrn UTSW 2 130995066 missense probably damaging 1.00
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0403:Atrn UTSW 2 130906859 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R1982:Atrn UTSW 2 130970222 missense probably benign
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4510:Atrn UTSW 2 130935577 nonsense probably null
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5141:Atrn UTSW 2 130999130 intron probably benign
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6023:Atrn UTSW 2 131020980 missense probably benign 0.25
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
R7402:Atrn UTSW 2 130947600 missense probably damaging 1.00
R7541:Atrn UTSW 2 130961571 missense possibly damaging 0.46
R7587:Atrn UTSW 2 130980114 missense probably damaging 1.00
R7872:Atrn UTSW 2 130970227 critical splice donor site probably null
R7910:Atrn UTSW 2 130964887 missense probably benign 0.04
R7913:Atrn UTSW 2 130970211 missense probably damaging 1.00
R7933:Atrn UTSW 2 130995066 missense probably damaging 1.00
R8044:Atrn UTSW 2 130935529 missense probably damaging 1.00
R8079:Atrn UTSW 2 131013641 missense probably null 1.00
R8093:Atrn UTSW 2 130975988 missense probably benign 0.00
R8203:Atrn UTSW 2 130960549 missense probably benign 0.00
R8234:Atrn UTSW 2 131023000 critical splice acceptor site probably null
R8462:Atrn UTSW 2 130935584 missense probably damaging 1.00
R8816:Atrn UTSW 2 130906878 missense probably damaging 1.00
R8816:Atrn UTSW 2 131004574 missense probably damaging 1.00
R8831:Atrn UTSW 2 130906601 missense probably benign 0.22
R8937:Atrn UTSW 2 130999237 missense probably benign 0.00
R9161:Atrn UTSW 2 130935550 missense probably damaging 1.00
RF009:Atrn UTSW 2 130906922 missense probably benign 0.12
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Z1176:Atrn UTSW 2 130946193 missense probably benign 0.27
Z1177:Atrn UTSW 2 130946042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTGGAACCTTGGGCAGGATAGAC -3'
(R):5'- AGGTCACAGGTTGAATATCATCAAGCAC -3'

Sequencing Primer
(F):5'- AGACAGATGAGCTAAGATTCCTTC -3'
(R):5'- ATATTCCCACCCTGATACTGTCTG -3'
Posted On 2014-01-05